ID: 1191705753

View in Genome Browser
Species Human (GRCh38)
Location X:64092985-64093007
Sequence TCCCCAATAGATCCCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191705753_1191705754 -9 Left 1191705753 X:64092985-64093007 CCATTTTGGGGATCTATTGGGGA No data
Right 1191705754 X:64092999-64093021 TATTGGGGAAAATTTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191705753 Original CRISPR TCCCCAATAGATCCCCAAAA TGG (reversed) Intergenic
No off target data available for this crispr