ID: 1191712005

View in Genome Browser
Species Human (GRCh38)
Location X:64159922-64159944
Sequence TAGCCACTAGGTTTACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191712005_1191712014 -4 Left 1191712005 X:64159922-64159944 CCTCACAGTAAACCTAGTGGCTA No data
Right 1191712014 X:64159941-64159963 GCTAAGGAGGGAGGGAGGGAAGG No data
1191712005_1191712013 -8 Left 1191712005 X:64159922-64159944 CCTCACAGTAAACCTAGTGGCTA No data
Right 1191712013 X:64159937-64159959 AGTGGCTAAGGAGGGAGGGAGGG No data
1191712005_1191712016 28 Left 1191712005 X:64159922-64159944 CCTCACAGTAAACCTAGTGGCTA No data
Right 1191712016 X:64159973-64159995 ATTCATTTTACTGATAGATGAGG No data
1191712005_1191712012 -9 Left 1191712005 X:64159922-64159944 CCTCACAGTAAACCTAGTGGCTA No data
Right 1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191712005 Original CRISPR TAGCCACTAGGTTTACTGTG AGG (reversed) Intergenic
No off target data available for this crispr