ID: 1191714462

View in Genome Browser
Species Human (GRCh38)
Location X:64184783-64184805
Sequence CCTCAATTTCTGCAAGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191714462_1191714464 7 Left 1191714462 X:64184783-64184805 CCACATACTTGCAGAAATTGAGG No data
Right 1191714464 X:64184813-64184835 TAGAAGTGCTAGCCAGCCCCTGG No data
1191714462_1191714471 27 Left 1191714462 X:64184783-64184805 CCACATACTTGCAGAAATTGAGG No data
Right 1191714471 X:64184833-64184855 TGGCAGTGCACAGGGACTTAAGG No data
1191714462_1191714465 18 Left 1191714462 X:64184783-64184805 CCACATACTTGCAGAAATTGAGG No data
Right 1191714465 X:64184824-64184846 GCCAGCCCCTGGCAGTGCACAGG No data
1191714462_1191714472 28 Left 1191714462 X:64184783-64184805 CCACATACTTGCAGAAATTGAGG No data
Right 1191714472 X:64184834-64184856 GGCAGTGCACAGGGACTTAAGGG No data
1191714462_1191714473 29 Left 1191714462 X:64184783-64184805 CCACATACTTGCAGAAATTGAGG No data
Right 1191714473 X:64184835-64184857 GCAGTGCACAGGGACTTAAGGGG No data
1191714462_1191714467 19 Left 1191714462 X:64184783-64184805 CCACATACTTGCAGAAATTGAGG No data
Right 1191714467 X:64184825-64184847 CCAGCCCCTGGCAGTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191714462 Original CRISPR CCTCAATTTCTGCAAGTATG TGG (reversed) Intergenic
No off target data available for this crispr