ID: 1191715732

View in Genome Browser
Species Human (GRCh38)
Location X:64192406-64192428
Sequence ACTACCTTCTCCCCTGTTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191715728_1191715732 12 Left 1191715728 X:64192371-64192393 CCACAGGGCCATTGGGTGGGTTT 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 188
1191715726_1191715732 14 Left 1191715726 X:64192369-64192391 CCCCACAGGGCCATTGGGTGGGT 0: 1
1: 0
2: 0
3: 38
4: 212
Right 1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 188
1191715724_1191715732 15 Left 1191715724 X:64192368-64192390 CCCCCACAGGGCCATTGGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 188
1191715727_1191715732 13 Left 1191715727 X:64192370-64192392 CCCACAGGGCCATTGGGTGGGTT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 188
1191715729_1191715732 4 Left 1191715729 X:64192379-64192401 CCATTGGGTGGGTTTACCTCTCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191715732 Original CRISPR ACTACCTTCTCCCCTGTTTC TGG Exonic
901016572 1:6235416-6235438 CCTACCTGCTGCCCTGTCTCAGG - Intronic
902444973 1:16456814-16456836 ACCACATTCTCCCATGTTGCTGG + Intronic
903615197 1:24647808-24647830 AAAACTTTCTCCCCTGTTCCTGG - Intronic
907473387 1:54689219-54689241 TCAGCCTTCTCCCCTGTGTCTGG - Intronic
908019336 1:59884194-59884216 ACTCCCTGCTCCCATATTTCTGG - Intergenic
909294668 1:73932394-73932416 ACTTTCTTCTACTCTGTTTCTGG - Intergenic
911039302 1:93579375-93579397 ACTTCCTTCTTCCCTGTCTCTGG - Intronic
912512980 1:110201021-110201043 ACGCCCTCCTTCCCTGTTTCTGG - Exonic
913314333 1:117537335-117537357 ACTCCCTTCTCCTTGGTTTCTGG - Intergenic
918403729 1:184191320-184191342 CCCACCCTCTCCCCTGATTCAGG - Intergenic
920665141 1:207958172-207958194 GCTACCTTCTGCCCTGTGTCTGG + Intergenic
921405014 1:214769196-214769218 ACTCCATTCCCTCCTGTTTCTGG + Intergenic
1063534371 10:6868936-6868958 TCTGCCTTCACCCCTGTTTCTGG - Intergenic
1066399367 10:35060144-35060166 ACACCCTTCTCCCCAGTTGCTGG - Intronic
1066449157 10:35512322-35512344 ACTTCCTTCTCCCCTCTGTTGGG - Intronic
1066721117 10:38340333-38340355 AATACCTTCCTTCCTGTTTCAGG - Intergenic
1068270317 10:54715516-54715538 ACTATCTTCTCCCTTGGATCTGG - Intronic
1073106542 10:101035573-101035595 ACCACCTTCTCCCCTGTGTCCGG - Exonic
1074817992 10:117157773-117157795 AAGAACTTCTCCCCTATTTCAGG + Intergenic
1076637162 10:131889647-131889669 ACTGCCTTCTCCTTTGTTTGAGG + Intergenic
1078869576 11:15330874-15330896 ACCACTTTCTCCCCTGCTTCAGG + Intergenic
1080955838 11:37094619-37094641 TGTACCCTCTTCCCTGTTTCTGG + Intergenic
1081700325 11:45148428-45148450 AGTACCTTCTGCCGTGATTCTGG - Intronic
1084857175 11:71996715-71996737 ACTCCCTTCTTCCCTGTGTGGGG + Exonic
1085562305 11:77483229-77483251 CCTACTTTCTCCACTCTTTCAGG - Intergenic
1087899112 11:103620896-103620918 ACTACCTTCTCCACTCTGCCAGG - Intergenic
1089373191 11:117976153-117976175 TCTATATTCTCCCCTGTCTCTGG - Intergenic
1089915989 11:122156959-122156981 ACTAGTGTCTCCCCTGCTTCAGG - Intergenic
1094415045 12:30207293-30207315 ACTCCCTTATCATCTGTTTCTGG - Intergenic
1095198644 12:39355884-39355906 AGTACTATCTCCACTGTTTCTGG - Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097593724 12:61602452-61602474 ACTACCTTCTGCTTTGCTTCTGG + Intergenic
1099867455 12:88301279-88301301 ACAACTTTATCCCCAGTTTCTGG - Intergenic
1102941143 12:116943226-116943248 ACTGCCTTTTCCCCTGTGTATGG + Intronic
1103010967 12:117457933-117457955 TATACCCTCTCCCATGTTTCTGG + Exonic
1103818137 12:123675351-123675373 ACTGCCATGTCCCCTGTCTCCGG + Intronic
1104170889 12:126279187-126279209 ACTGCTTTCTCCCCTGGGTCTGG - Intergenic
1104729732 12:131098196-131098218 ACTGCCTTCTCTGCTTTTTCAGG + Intronic
1105266750 13:18825830-18825852 ATTACTTTCTCACCTGATTCTGG + Intergenic
1105488525 13:20862148-20862170 TCTTCCCTCTCCCCTGTTTTAGG + Intronic
1105773654 13:23636652-23636674 TCTGCCTCCTCCCCTCTTTCAGG - Intronic
1106184709 13:27399225-27399247 AGTCACTTCTCCCCTGTTTCTGG - Intergenic
1107144028 13:37037560-37037582 ACTACCTTATCCCCAGTTCCTGG - Intronic
1109838217 13:67886687-67886709 ACAACATTTTCTCCTGTTTCAGG - Intergenic
1110142153 13:72143732-72143754 ATGACCTTCTCCTCTGTGTCTGG - Intergenic
1111663031 13:91234920-91234942 ACTATCCTTTCCCCTCTTTCAGG - Intergenic
1112345005 13:98581890-98581912 ACTGCCTCCTCCCCTGTGTTGGG + Intergenic
1112813372 13:103245162-103245184 ACCACCATCTCCCCACTTTCTGG - Intergenic
1113008096 13:105730508-105730530 AGTAACAGCTCCCCTGTTTCTGG + Intergenic
1113148491 13:107235906-107235928 ACTATCATCTCCCATGTTTTGGG + Intronic
1113353225 13:109550154-109550176 CCTACCTTCTCCCCTATTTTAGG + Intergenic
1114562389 14:23602808-23602830 ACCACATTCTCACCAGTTTCTGG + Intergenic
1115138581 14:30141580-30141602 AATACATTCTCTTCTGTTTCTGG - Intronic
1119356230 14:74009062-74009084 ACTTCATTCTCCATTGTTTCAGG + Intronic
1119376593 14:74199094-74199116 ACTGCCCTCTCCCCTGCTCCTGG + Exonic
1124510774 15:30322649-30322671 ACTACATTTACCCATGTTTCTGG + Intergenic
1124732114 15:32207886-32207908 ACTACATTTACCCATGTTTCTGG - Intergenic
1125285756 15:38090803-38090825 ACTCCCTTCTCCACTGCTTTGGG + Intergenic
1125717936 15:41830309-41830331 ACTGGCTTCTTCACTGTTTCCGG + Intronic
1127499145 15:59540764-59540786 TCCACCTTCACCCCAGTTTCTGG - Intergenic
1129962790 15:79703156-79703178 TCTCCCTTCTCCCCTGTTTTGGG + Intergenic
1130150589 15:81308583-81308605 ATTACCTTCTCCCTCATTTCAGG + Exonic
1131561225 15:93442207-93442229 ACTGCCTTTTCCCCTCTGTCGGG - Intergenic
1133063166 16:3188531-3188553 CCTCCCTTCTCCCCCGCTTCCGG - Intergenic
1134037121 16:11039732-11039754 ACATCCTTCTCCTCTGTTCCAGG + Exonic
1137411559 16:48232632-48232654 ACTACCTTCTCTCCTGTCCCAGG - Intronic
1138971250 16:62146244-62146266 ACAACTTTCTCACCTGTTTCAGG - Intergenic
1139960836 16:70716440-70716462 AATACCTTCTCCCCGGTCTGTGG + Intronic
1142265025 16:89060003-89060025 ACTTTTTTCTCCCTTGTTTCAGG - Intergenic
1147387893 17:40092399-40092421 CCTACCTCCTTCCCTGTTTCTGG - Intronic
1148334763 17:46833825-46833847 ACTTCCTTCGCCTCTTTTTCTGG + Intronic
1151601354 17:75108237-75108259 ACTTCCATCCTCCCTGTTTCTGG + Intergenic
1152061782 17:78081638-78081660 GCTGCCTTTTCCCCTGTTCCTGG - Intronic
1153082263 18:1241678-1241700 ACTACCTTTTCCCCAGTCCCAGG + Intergenic
1155738574 18:29256185-29256207 GCTACCTTCTGCCCTGTGTCTGG - Intergenic
1155748816 18:29394315-29394337 ATTTTCTTCTCTCCTGTTTCAGG - Intergenic
1162348199 19:10133638-10133660 CCTCCCGTCACCCCTGTTTCTGG - Exonic
1163303036 19:16459742-16459764 ACGGCCTGCTCCCCTGTCTCAGG - Intronic
1165334699 19:35161379-35161401 ACTAACTTCTCCCCTCTTGATGG + Intronic
1165746344 19:38232082-38232104 ACTAGCTTCCTCCCTATTTCTGG + Intergenic
1166827573 19:45618997-45619019 ACTACCTTTCCCCCTGTGTCAGG - Intronic
1168706035 19:58470811-58470833 ACTAGCGTCTTCCCTGTTGCCGG + Exonic
926978050 2:18534605-18534627 AGTTTCTTCTGCCCTGTTTCAGG + Intergenic
927371860 2:22365110-22365132 AGTCCCTTCTCCTCAGTTTCTGG + Intergenic
927718051 2:25365176-25365198 AGCTCCTTCTCCCATGTTTCAGG + Intergenic
929776072 2:44931710-44931732 ACCCCCTGCTCCCCTGTCTCTGG - Intergenic
930513300 2:52373571-52373593 ACAACCATCTCCCCTGTTTGAGG - Intergenic
931542569 2:63345836-63345858 AGTACCTACTCCCCTCTCTCAGG + Intronic
933532805 2:83531748-83531770 ACTTCCTTCTCCCTTGTCTGAGG + Intergenic
933594537 2:84269531-84269553 TCTATCTTCTCCCCTTTTTGAGG + Intergenic
933709256 2:85313797-85313819 CCTCCCTTCTCCCCTGTCCCAGG + Intergenic
933713650 2:85345020-85345042 CCTCCCTTCTCCCCTGTCCCAGG - Intronic
937280455 2:120713985-120714007 TCTCCCTTCACCCCTGTTGCAGG - Intergenic
939242758 2:139582698-139582720 AGTACCTACTCGCCTGTGTCTGG - Intergenic
940690046 2:156905173-156905195 ACTAACTCCTCCCATCTTTCAGG - Intergenic
943440749 2:187924656-187924678 AAGACCATCTCCCCTTTTTCTGG - Intergenic
944114514 2:196171932-196171954 GCTTCCTTCTCCCCGGTCTCCGG - Intronic
946307078 2:218862107-218862129 ACTCCCTTCTTCCCAGCTTCAGG - Intronic
947386045 2:229591605-229591627 ACAACTTTCTGCCCTGTTTTCGG + Exonic
948298752 2:236886052-236886074 AATAGCTTCTCCTCTGTATCAGG + Intergenic
948496824 2:238356063-238356085 ATTACCTTCTCCCCAGGTTTGGG - Exonic
1169300603 20:4439013-4439035 ACTGCCTTCTCTCCTTTTTGGGG - Intergenic
1171101401 20:22386807-22386829 ATTTGCTTCTCCACTGTTTCAGG + Intergenic
1173135760 20:40437535-40437557 ACTACCATCACCCCTGCTTTAGG + Intergenic
1174085235 20:48003361-48003383 ACAACAATATCCCCTGTTTCAGG + Intergenic
1174087550 20:48019870-48019892 AAAGCCCTCTCCCCTGTTTCCGG + Intergenic
1174363564 20:50043143-50043165 GCCACCTTCACCCCTGTCTCGGG + Intergenic
1175567638 20:59993412-59993434 GCTCCCTCCTCCCCTGCTTCTGG + Intronic
1175710165 20:61213620-61213642 ACTACCTGCTCCCCCAATTCTGG + Intergenic
1179043977 21:37829158-37829180 ACCACCTCCACCCCTGGTTCAGG - Intronic
1180559119 22:16601616-16601638 ACTTCCTCCTCCCCTGCTCCGGG + Intergenic
1180964858 22:19782754-19782776 TCTAGCTCCTTCCCTGTTTCTGG + Intronic
1181888112 22:26037713-26037735 TCTCCCTTCTCCCATGTTTGAGG + Intergenic
1183686689 22:39365082-39365104 CCTCCATCCTCCCCTGTTTCTGG + Intronic
1184419909 22:44373771-44373793 ACTACCGTCTCCCCTTTCTCAGG - Intergenic
1184728388 22:46358982-46359004 CCTGCCTTCTCCCCAGTCTCTGG + Intergenic
1184762265 22:46551333-46551355 ACTGCCGTCTCTCCAGTTTCTGG + Intergenic
949302442 3:2600146-2600168 ACTACTCTCTCCTCTCTTTCTGG + Intronic
949525581 3:4900215-4900237 ACGACCTTCTCCTCTCTTTCTGG + Intergenic
952502811 3:33979779-33979801 CCTACCTTGTCCCCTGATTATGG - Intergenic
952801056 3:37292282-37292304 ACTCCCTTCTCCCCCACTTCTGG - Intronic
953824491 3:46238928-46238950 ACTCCCTTATCCCCTGTCCCAGG - Intronic
953926567 3:46985656-46985678 ACAACCTTCTCCCCTGCTGCAGG + Intronic
956617913 3:71191485-71191507 ACCACATTCTCCTCTGTTACAGG + Intronic
957186582 3:76949512-76949534 ACAGCCTTCTCCCCTATTTAAGG + Intronic
957186591 3:76949547-76949569 AAGGGCTTCTCCCCTGTTTCCGG + Intronic
958545545 3:95544396-95544418 ATTTCCTTCTACTCTGTTTCTGG + Intergenic
959822875 3:110757152-110757174 TCTGCCTTCTCCCTTCTTTCTGG + Intergenic
959824081 3:110771946-110771968 ATTACTATCTCCCCTGCTTCAGG + Intergenic
962501830 3:136002456-136002478 ACTCCCTTCTCCCCAGTGTTTGG + Exonic
962528292 3:136255301-136255323 ACTATCCTATCCCCTGTTTAGGG - Intronic
963604342 3:147401513-147401535 AGTTCTTTCTTCCCTGTTTCTGG + Intronic
967974013 3:195021058-195021080 TCTACCTTCACCCCTGAATCTGG + Intergenic
970191776 4:13524584-13524606 GCTACCTTCTCCTGTGTTTCAGG - Intergenic
970228307 4:13882418-13882440 CTTACCTTCTCCCCTTTTCCAGG - Intergenic
972487659 4:39557582-39557604 GCTACCTTCTGCCCTGTGTCTGG + Intronic
975738689 4:77407196-77407218 ACTACCTTCTCCCATTTTAAAGG + Intronic
977510065 4:97951977-97951999 GCTACCTCCGCCCCTGTGTCAGG + Intronic
980544130 4:134235319-134235341 ACTACCATCTGCCTTTTTTCTGG - Intergenic
981451507 4:144903499-144903521 ACTACCTTGTCTCCTGGTGCTGG + Intergenic
986685263 5:10270833-10270855 ACCTCCTTCCCTCCTGTTTCTGG + Intergenic
987212223 5:15694421-15694443 ATTACCTTCAACCCTGTGTCAGG - Intronic
991406544 5:66305800-66305822 TCCTCCTTCTCCCCTGATTCAGG - Intergenic
991711294 5:69411490-69411512 CCTACCTTTTCTCCTATTTCTGG + Intronic
992564692 5:77985849-77985871 ACTACCTTCTGGGCTGTTCCCGG + Intergenic
993355517 5:86902355-86902377 ACTAACTTCTGCCCTATTTTTGG + Intergenic
993971808 5:94429398-94429420 TTTCCCTTTTCCCCTGTTTCTGG + Intronic
995572529 5:113495397-113495419 CCTCCCTTCTCCCCAGTTTGGGG - Intergenic
997380157 5:133429866-133429888 AGTCCCTTCTCTCCTATTTCAGG + Intronic
997831692 5:137156015-137156037 ACTACGTTTACTCCTGTTTCAGG + Intronic
997992338 5:138555413-138555435 GCTACCTTCTGCCCTGTGTCTGG - Exonic
998490524 5:142542455-142542477 ACTTCCTTCTCCCCCATTTTTGG - Intergenic
999563022 5:152825815-152825837 CCTACATTCTACCCTGGTTCTGG - Intergenic
999779556 5:154838089-154838111 ACTACATTCTCACCAGTTTGGGG + Intronic
1000105714 5:158057008-158057030 ATGACCATCTCCCCTGTTTTTGG + Intergenic
1000948812 5:167454958-167454980 ACTACTCTCTCCCTTATTTCTGG - Intronic
1003448547 6:6208380-6208402 AGTAACATCTCACCTGTTTCTGG - Intronic
1004403479 6:15310552-15310574 CCCCTCTTCTCCCCTGTTTCTGG + Intronic
1005855449 6:29858958-29858980 CCTACATTCTTCCCAGTTTCTGG - Intergenic
1006441315 6:34055462-34055484 ACTCACTTCTCCCCTGGCTCTGG + Intronic
1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG + Intergenic
1008225613 6:48911668-48911690 AGAACCTACTCCTCTGTTTCAGG - Intergenic
1009994021 6:70879537-70879559 ACCACCTTCTCCCCAGTCCCTGG - Intronic
1010915573 6:81613883-81613905 CCTTCCTTCTTCCCTGTTCCAGG - Intronic
1011583134 6:88894401-88894423 GCTACCTTCTGCCCTGTGTCTGG - Intronic
1013757402 6:113477688-113477710 GCTCCCTTCTCCCTTGTTGCTGG + Intergenic
1016349938 6:143156011-143156033 ACTCCCTTCACCCCAGCTTCAGG - Intronic
1016811981 6:148270168-148270190 GCCACCCTCTTCCCTGTTTCTGG - Intergenic
1018477886 6:164160870-164160892 ACTACTTTCTCTTCTGTTTATGG - Intergenic
1018899434 6:168043813-168043835 CCTTCCTTCTCCACTGTTTTTGG + Intronic
1021197450 7:17688954-17688976 ACTACGTTGTCCTCTGTTCCTGG - Intergenic
1021575495 7:22102258-22102280 ACCACCTTCTCCATTGTTTGGGG + Intergenic
1023200026 7:37686972-37686994 ACTATCTTCTACCCAGTCTCAGG - Intronic
1023608345 7:41949876-41949898 ACCCCCTTCTCCCCTGATTTAGG - Intergenic
1024324201 7:48096010-48096032 AATGCCTTGTCCCCAGTTTCTGG + Intronic
1028180017 7:87708680-87708702 TCCACCTTCTTTCCTGTTTCAGG - Intronic
1028446091 7:90926160-90926182 CCTACCTTCTCACATGTTTGGGG - Intronic
1034112679 7:148553441-148553463 ACAACCTTCTTCCCAGTTTCAGG - Intergenic
1034565154 7:151908285-151908307 TCTTCCTTCTCCTCTGTTGCTGG + Intergenic
1034618202 7:152436391-152436413 ACTTCCTCCTCCCCTGCTCCGGG - Intergenic
1035093736 7:156334945-156334967 GTTTCCTTCTCCCATGTTTCTGG - Intergenic
1037937530 8:22925329-22925351 ACAACCTTCACCCCAGGTTCAGG - Intronic
1040629375 8:49192026-49192048 ACCACCTTCACCCCAGCTTCTGG - Intergenic
1040951047 8:52939479-52939501 AAACCCTTCTCCCCTCTTTCAGG - Exonic
1041035709 8:53787282-53787304 TATCCCTTATCCCCTGTTTCAGG - Intronic
1041321001 8:56612431-56612453 GCTGCATTCTCTCCTGTTTCTGG + Intergenic
1041929888 8:63275111-63275133 ACGACATTCTCTGCTGTTTCCGG + Intergenic
1043698586 8:83253652-83253674 ACTGCCTTTTCCCCTGTGTATGG + Intergenic
1048865065 8:138754755-138754777 ACTCACTTTTCCCATGTTTCTGG - Intronic
1049263713 8:141653667-141653689 CCTACCTTCCCTCCTGTTCCTGG - Intergenic
1055680876 9:78713954-78713976 ACTACCTTGGCCTTTGTTTCTGG - Intergenic
1060586874 9:124792174-124792196 ACTACCTGTGCCCCTGATTCTGG + Intronic
1061154267 9:128847562-128847584 CCTCCCTTCTCCCCTGCCTCTGG - Intronic
1062055727 9:134468924-134468946 GCAACCTCCTCCCCTGTCTCTGG + Intergenic
1062658486 9:137615965-137615987 ACCACCATCTCCGTTGTTTCTGG - Exonic
1186479853 X:9888287-9888309 ACTTCCTTCTCTCCTGTGTCTGG + Intronic
1186682769 X:11893154-11893176 ACTACTTTATCTTCTGTTTCAGG + Intergenic
1186893704 X:13985273-13985295 ACTATGGGCTCCCCTGTTTCTGG - Intergenic
1187076111 X:15936913-15936935 ACTATCTTCTGCCATGTTTATGG - Intergenic
1187941443 X:24386524-24386546 ACCACCTTCTCCACTATTTTTGG - Intergenic
1188050261 X:25475958-25475980 GCTAGCTTCTACCCTCTTTCAGG + Intergenic
1188522801 X:31057554-31057576 TCTACCTCCTCTCCTGTTACTGG - Intergenic
1191715732 X:64192406-64192428 ACTACCTTCTCCCCTGTTTCTGG + Exonic
1192085798 X:68096100-68096122 TCTACCTTCTCCCCTGGAGCAGG + Intronic
1192859772 X:75054947-75054969 ACAATTTCCTCCCCTGTTTCTGG + Intronic
1193889417 X:87026226-87026248 CCTTTCTTCTCCCCGGTTTCTGG - Intergenic
1194467408 X:94250896-94250918 ACTACATTCTCCATTGTTTGGGG + Intergenic
1195859142 X:109362421-109362443 ACTTCCTTTCTCCCTGTTTCAGG - Intergenic
1196198181 X:112857051-112857073 TCTACCTTCTCCCCTCAGTCAGG - Intergenic
1196851190 X:119940675-119940697 AATACCTTTTCCCCTGATTAAGG - Intronic
1201390577 Y:13492941-13492963 ACTACCTTCCAGCCAGTTTCAGG - Intergenic