ID: 1191715851

View in Genome Browser
Species Human (GRCh38)
Location X:64193036-64193058
Sequence CGGAGCAAAGGTTCTGGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191715851_1191715856 -2 Left 1191715851 X:64193036-64193058 CCTTTCCCAGAACCTTTGCTCCG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1191715856 X:64193057-64193079 CGTCCCCCTCCAAAGAAACTAGG 0: 1
1: 0
2: 0
3: 14
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191715851 Original CRISPR CGGAGCAAAGGTTCTGGGAA AGG (reversed) Exonic