ID: 1191716130

View in Genome Browser
Species Human (GRCh38)
Location X:64194782-64194804
Sequence CTGTGGACCAGCACTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191716126_1191716130 17 Left 1191716126 X:64194742-64194764 CCATAATAATAAGACTCACACAT 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG 0: 1
1: 0
2: 1
3: 39
4: 345
1191716129_1191716130 -9 Left 1191716129 X:64194768-64194790 CCTAAAGTGGAAGACTGTGGACC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG 0: 1
1: 0
2: 1
3: 39
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191716130 Original CRISPR CTGTGGACCAGCACTGAGCA TGG Intronic
900290184 1:1920443-1920465 ATGTGGAACAGTTCTGAGCAAGG - Intergenic
901681416 1:10914954-10914976 CTGTGACCCAGCACAGAGCCTGG + Intergenic
901874949 1:12162095-12162117 CTGTGGGCCAGCCTTAAGCAGGG + Intergenic
901946330 1:12706982-12707004 CTGTGGACCACTAAAGAGCAAGG - Intergenic
902051990 1:13571028-13571050 CTGTGGACCACTAAAGAGCAAGG + Intergenic
902447656 1:16477151-16477173 CTGTGGACCAGGCCTGAGGCAGG + Intergenic
902742457 1:18448445-18448467 CTGTGGTCCAGGACTCGGCAAGG - Intergenic
903334366 1:22615054-22615076 TTGAGCACCAGCACTGAGCCAGG - Intergenic
904333900 1:29784840-29784862 CTGCTGTCCAGCACTGAGGATGG + Intergenic
904352589 1:29918628-29918650 CTGTGGACCGGGACTGTGCTAGG + Intergenic
904398829 1:30242210-30242232 CTGTGCACCAGCACTGTGTCAGG - Intergenic
904532411 1:31177947-31177969 CTGTGGACCACTCCTGACCATGG - Intergenic
904563434 1:31413492-31413514 CTGCCGGCCAGGACTGAGCAGGG - Intronic
904712953 1:32444753-32444775 CTGTGGACCACTAAAGAGCAAGG - Intergenic
905345121 1:37306090-37306112 CTGGGGCCCATCCCTGAGCAGGG - Intergenic
906128294 1:43441128-43441150 CTATGGAACAGCAGTGAGCTAGG - Intronic
906787839 1:48631356-48631378 CTGTACACCAGCACTGTGCTAGG + Intronic
906830176 1:49022820-49022842 CTGTGTACCAGCACTATGCTAGG + Intronic
907433377 1:54428073-54428095 CTGTGTACCAGCCTTGAGCTAGG + Intergenic
908624449 1:66024454-66024476 CTGTTGACCAACACTTAGAAAGG + Intronic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
910808069 1:91208370-91208392 CTGTGGACCACTAAAGAGCAAGG - Intergenic
911043065 1:93607287-93607309 ATGGGGACCAGGAATGAGCATGG + Intronic
911576159 1:99580877-99580899 CTTTGGACCAGCAATAGGCAGGG + Intergenic
914958229 1:152183908-152183930 CTGAGTATCAGCTCTGAGCAAGG - Intergenic
915552518 1:156643496-156643518 CTGAGCTCCAGCACTCAGCAGGG - Intronic
915651324 1:157313111-157313133 CCCTGGACCATGACTGAGCAGGG + Intergenic
917454515 1:175174553-175174575 ATGTGGAAGAACACTGAGCAGGG + Intronic
918084929 1:181237309-181237331 CAGTGGAACAGAACAGAGCAGGG + Intergenic
918370492 1:183856534-183856556 GTGTGGACCAAAACTGAACAGGG - Intronic
919299684 1:195744209-195744231 CTGTGGACCAGAATGGGGCAGGG + Intergenic
919802777 1:201363543-201363565 CTGTGGGCCAGCACTGTGCTGGG - Intronic
921074648 1:211690538-211690560 CTGTGGACCACTACAGAACAAGG + Intergenic
924258470 1:242205759-242205781 CTCAGTACCAGCACTGAGCAGGG + Intronic
924859062 1:247902366-247902388 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1064253458 10:13724785-13724807 ACGTGGACCAGCACTGAGAAAGG - Intronic
1064756519 10:18576452-18576474 CTGTGGACCACTAAAGAGCAAGG + Intronic
1065183137 10:23146472-23146494 CTCTGCACCAGCACTGGGAAGGG + Intergenic
1065574616 10:27105001-27105023 CTGTGGACCAGCTCTGGCCTTGG - Intergenic
1065931014 10:30479149-30479171 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1067287911 10:44920973-44920995 CTGTGGTACAGCCCTGGGCAGGG - Intronic
1068012926 10:51477217-51477239 CTGGGGAGCATCACTGAGAAAGG + Intronic
1068671789 10:59730512-59730534 CTGTGGACCACTACAGAGCAAGG - Intronic
1068675788 10:59767989-59768011 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1072334808 10:94388553-94388575 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1072574805 10:96689864-96689886 CTGTGGGCCTGCGCTGAGCAGGG - Intronic
1072719172 10:97770478-97770500 ATGTGGACCAGCACAGAAAAGGG + Intronic
1074151332 10:110762322-110762344 CTGTATACCAGCACTGTGCCAGG - Intronic
1075079574 10:119374315-119374337 CAGTGGATGAGCACTGGGCAGGG - Intronic
1075222999 10:120600806-120600828 GTGGGCACCAGCACAGAGCAGGG - Intergenic
1075638065 10:124043884-124043906 CAGAGGAACAGCACAGAGCAGGG + Intronic
1075638068 10:124043902-124043924 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638071 10:124043920-124043942 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638074 10:124043938-124043960 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638079 10:124043990-124044012 CAGAGGAACAGCACAGAGCAGGG + Intronic
1076031465 10:127162803-127162825 CTGTGTGTCAGCACTGTGCATGG + Intronic
1076199466 10:128546903-128546925 CTGAGGACAGGCACTGAGCCAGG - Intergenic
1076883241 10:133249608-133249630 TGGGGGACCAGCCCTGAGCAGGG - Intergenic
1080235337 11:30062014-30062036 CTGTGGGACATCACTGAGTATGG + Intergenic
1081537778 11:44007803-44007825 CTGTGTGCCAGCCCTGAGCTTGG - Intergenic
1083333807 11:61911599-61911621 CGGTGGACCCGGACTGAGGAGGG - Intronic
1083651460 11:64207048-64207070 CTGTGGGCTGGCATTGAGCACGG + Intronic
1083726434 11:64630910-64630932 CTGGGGACCAGCTCGGGGCATGG + Intronic
1084150500 11:67285885-67285907 CTGTGGAGCAGGACAGTGCAGGG - Exonic
1085239789 11:75043760-75043782 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1085422624 11:76376851-76376873 CTGTGGTCCAGAACTGACTAGGG + Intronic
1085534281 11:77208741-77208763 CTGTGGACCACCACGGTGCCAGG + Exonic
1086973455 11:93107552-93107574 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1087456796 11:98396743-98396765 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1087684522 11:101248246-101248268 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1087715599 11:101605129-101605151 CAGTGGAGCTGCACTTAGCAAGG - Intronic
1087894816 11:103575742-103575764 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1087947586 11:104182669-104182691 CTGTGTACCAACACTGAGCCAGG + Intergenic
1088830287 11:113530984-113531006 GTGTTGCCCAGCACAGAGCATGG + Intergenic
1090670566 11:128942372-128942394 CTGTGGACCAGGACTGACCCAGG + Intronic
1090734027 11:129595686-129595708 CTGTGTACCAGCGCTGTGTATGG + Intergenic
1091016449 11:132055303-132055325 CTTGGGACTAGCCCTGAGCATGG + Intronic
1091814510 12:3426388-3426410 CTGTGGACCACTAAAGAGCAAGG - Intronic
1092099681 12:5872851-5872873 CTGTGGACCAGGGCTCAGCCTGG - Intronic
1092394622 12:8114725-8114747 CCTTGGACAAGCACTAAGCAGGG - Intergenic
1092596525 12:10011557-10011579 CTGAAGACCAGCACTGAGACTGG - Intronic
1093073975 12:14737983-14738005 ATGTGGAGCAGAACTGAGGAGGG - Intergenic
1093201648 12:16194270-16194292 CTGGGAACCATCACTGAGCCAGG - Intronic
1095162346 12:38933141-38933163 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1095824528 12:46517158-46517180 CTGGGGAACAGCACAGAGCCAGG - Intergenic
1096793272 12:54058333-54058355 CTGGAGACCAGGGCTGAGCAAGG - Intergenic
1097147978 12:56954702-56954724 CTGTCGCCCAGCACTCAGGAAGG + Intronic
1097156580 12:57016387-57016409 CTGTGGAGCAGCTCTGTGCCGGG + Exonic
1098248400 12:68543918-68543940 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1098880308 12:75910441-75910463 CTGTGGAACAGCAGGCAGCAGGG - Intergenic
1099359046 12:81675640-81675662 CTATGGGCAAGCACTGTGCAAGG + Intronic
1101344457 12:103873319-103873341 GTCTGGAGCAGCACTGGGCATGG - Intergenic
1102287048 12:111666153-111666175 CTGTGTTCCAGCACTGTGCCAGG + Intronic
1103001123 12:117386162-117386184 CTGTGGACCAAGTCTGAGCCCGG + Intronic
1104250203 12:127086083-127086105 CTGTGGACCAGAAGTGAGTGTGG - Intergenic
1105803744 13:23936351-23936373 CTGTCTTCCAGCACTGTGCAGGG + Intergenic
1106419379 13:29572755-29572777 CAGTTGACCAGCACTGGGCGGGG + Intronic
1110277970 13:73660996-73661018 CTGTGGGAGAGCACTGAGGATGG + Intergenic
1110653702 13:77972465-77972487 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1111740235 13:92195881-92195903 CTGTGTACCAGGACTCAGAAGGG + Intronic
1113447059 13:110377415-110377437 CTCTGGAGGTGCACTGAGCAAGG + Intronic
1113779007 13:112965387-112965409 CTGAGGTGCAGCACTGAGCAAGG - Intronic
1114223495 14:20717745-20717767 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1114236080 14:20824879-20824901 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1115211372 14:30970365-30970387 CTGTGGACCACTAAAGAGCAAGG + Intronic
1116734501 14:48671451-48671473 CTCTGGACCAGCCCTGTGGAGGG - Intergenic
1117179536 14:53177918-53177940 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1117955190 14:61117403-61117425 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1119320185 14:73725948-73725970 CTGTGACTCAGCACTGAGCAGGG + Intronic
1120597822 14:86462941-86462963 TTGTGGACTAGCTCTGATCAAGG + Intergenic
1121314336 14:92952154-92952176 CTGGGCACCAGCCCTGGGCACGG + Intronic
1121519258 14:94574740-94574762 CTGAGCACCTGCAATGAGCAAGG + Intronic
1122406321 14:101503251-101503273 CTTTGGATCAGCACTTAGTAGGG - Intergenic
1122803684 14:104245880-104245902 CTCTGGACCAGAAGTGAGCATGG - Intergenic
1123428558 15:20193832-20193854 CTGTGTCCCAGCACTGCTCATGG - Intergenic
1124402544 15:29362115-29362137 CTGTGGAACAGCACTGAGTGGGG - Intronic
1125690330 15:41591043-41591065 CTGTGAACCACCAAAGAGCAAGG + Intergenic
1126133685 15:45369638-45369660 CTAGGGATCAGCACTGAACATGG - Intronic
1127477830 15:59351359-59351381 CTGTGTACAAGCACTGTGCTAGG + Intronic
1127735998 15:61839939-61839961 TTGAGGAGCTGCACTGAGCATGG - Intergenic
1129813642 15:78532377-78532399 TTGTAGACCAGCACTGGCCATGG + Intronic
1130915070 15:88298654-88298676 CTCTGTGCCAGCACTGAGCTGGG - Intergenic
1131260284 15:90884341-90884363 CTGCGGCCCAGCGCGGAGCAGGG + Intronic
1131693674 15:94854048-94854070 TTGTGGACCAGCCCTGTGGAGGG + Intergenic
1132146751 15:99433708-99433730 CTGTGGAACAGCACGGACAAGGG + Intergenic
1132812967 16:1810542-1810564 CTTCCGACCAGCACTGACCAGGG + Intronic
1132943001 16:2517578-2517600 CTGTGTCCCAGCACTCAGCAGGG - Intronic
1133343665 16:5055560-5055582 CTTTGGAGCAGCCCTGACCAAGG - Intronic
1134149367 16:11794038-11794060 CTGGGAACCACCACTTAGCAGGG - Intronic
1134799240 16:17069392-17069414 CTGGGAACCAGCACTGGGTATGG + Intergenic
1134867357 16:17620183-17620205 CACTGGACCAGGAGTGAGCAGGG - Intergenic
1136174529 16:28507847-28507869 ATGTGGCCCAGCCCTGACCATGG - Intronic
1136536195 16:30901242-30901264 CTCTGTACCTGCATTGAGCAGGG - Intronic
1136855759 16:33655900-33655922 CTGTGTCCCAGCACTGCTCATGG + Intergenic
1137767182 16:50987071-50987093 CTGAGGCCCAATACTGAGCAAGG + Intergenic
1137982400 16:53080965-53080987 CTGTGAGCCAGCACTGGCCAAGG - Intronic
1138395557 16:56701664-56701686 CTGTAGCCCAGCACTGATCTAGG - Intronic
1138511326 16:57510137-57510159 CTGTGAGATAGCACTGAGCAGGG - Intergenic
1139476829 16:67207020-67207042 CTGTGGGCCAGGCCTGAGGAAGG + Intergenic
1139561267 16:67743891-67743913 CTGTGGAGCAGCAGTGAGGGTGG - Intronic
1140670585 16:77274194-77274216 ATGTGGACCATCACTAACCAAGG - Intronic
1141302811 16:82833764-82833786 CTGTGGACTTGCACAGAGCCAGG - Intronic
1142036182 16:87863297-87863319 CTGTGGCCCGGCACTGATCCAGG - Intronic
1203117344 16_KI270728v1_random:1504381-1504403 CTGTGTCCCAGCACTGCTCATGG + Intergenic
1143236149 17:5402744-5402766 CTGTGGACCAGCACTTTGAGAGG + Intronic
1143455716 17:7066262-7066284 CTCTGTGCCAGCACTGAGCAGGG + Intergenic
1143457390 17:7077032-7077054 CTCTGTACCAGCACCGAGCAGGG + Intronic
1143517529 17:7427243-7427265 TGGGGGACCAGCACTGAGCTTGG - Exonic
1145060615 17:19731022-19731044 CTGTGGGCCAGCCCTGCCCAGGG - Intergenic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1146764167 17:35504317-35504339 CTGTGGACCACTAAAGAGCAAGG + Intronic
1148090162 17:45018701-45018723 CTGTGTGCCAGCCCTGGGCAGGG + Intergenic
1148188946 17:45665527-45665549 CTGGGGGCCAGACCTGAGCATGG + Intergenic
1148828958 17:50416751-50416773 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1149693447 17:58597804-58597826 CTGTGTCCCAGCACCTAGCATGG - Intronic
1151149626 17:72073783-72073805 CAGTGGTCCATCACTGAGCATGG + Intergenic
1151390214 17:73781891-73781913 CTGGGTACCAGGACTGAGCCAGG - Intergenic
1151552333 17:74829368-74829390 GTGTGGCCCAGCACTGAGGTGGG - Intronic
1151710113 17:75799616-75799638 CTGTGGGTCAGCTCTGTGCAGGG + Intronic
1152041472 17:77906516-77906538 CTCTGGGCCAGCACTGCCCAAGG + Intergenic
1152666154 17:81570760-81570782 CTGTGGCCCAGGGCTGGGCATGG + Intronic
1152738756 17:82009822-82009844 CTGAGGCACAGCTCTGAGCAGGG + Intronic
1153326911 18:3830121-3830143 CTCTGTACCAGCACCTAGCAAGG + Intronic
1154014126 18:10601439-10601461 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1154463245 18:14617657-14617679 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1156718556 18:40042070-40042092 CTGTGGAGCAGCAAAGAACAAGG - Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1158930750 18:62323850-62323872 CTGTGGAGCACCCCTAAGCATGG + Intergenic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1162267802 19:9590130-9590152 CTGTGGACCACCAAAGAGCAAGG - Intergenic
1162281905 19:9705494-9705516 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1163187668 19:15650340-15650362 CTGTGGACTAGCACCTACCAGGG + Intronic
1163639907 19:18456306-18456328 CTGTGGACCAGCACAGGGTTGGG + Intronic
1163991856 19:21006336-21006358 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1164121562 19:22269896-22269918 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1164853556 19:31503513-31503535 GTGTGGACCAGCACCAAACATGG - Intergenic
1167782143 19:51605756-51605778 CTGTGGATCAGCCCCGAGCTGGG - Intergenic
1168108699 19:54180144-54180166 CTGGGGAACAGCACTGGTCAGGG + Intronic
925636447 2:5945873-5945895 CTGTGGCCCAGCAGTGAGGGAGG + Intergenic
926491447 2:13530004-13530026 CTGTGGACCACTAAAGAGCAAGG - Intergenic
926705425 2:15834210-15834232 CTGTGGGCAAGGACTGAGCCTGG + Intergenic
927443247 2:23134926-23134948 CTGTGCAACACCACTGAGCTTGG + Intergenic
928824658 2:35405527-35405549 CTGTGTGCAAGCACTGAGGAAGG - Intergenic
929060614 2:37920932-37920954 CTGCGGAAAACCACTGAGCAAGG + Intergenic
929079016 2:38104099-38104121 CTATACACCAGCACTGTGCAGGG + Intronic
929132012 2:38585764-38585786 CTGTTGACCAGCAATGTACACGG + Exonic
932325779 2:70860637-70860659 CAGTGGAGCAGCATGGAGCAGGG + Intergenic
932572894 2:72947218-72947240 CTGTGGACCAGCATTGTGCTAGG - Intronic
932845129 2:75127465-75127487 CTGTGAATCAGCACTGGGCATGG - Intronic
933299912 2:80530065-80530087 CTGTGGTCCACTACTGACCATGG + Intronic
934554858 2:95281819-95281841 CTGTGGCACAGCACAGACCAGGG - Intronic
934975156 2:98796917-98796939 CGGTGGAGCAGCAAAGAGCAGGG + Intronic
935206777 2:100903129-100903151 CTGTGGACAAGCTCTGTCCAGGG + Intronic
935407892 2:102728323-102728345 TTGTGGAACATCACTGAGGAAGG - Intronic
935721482 2:105983146-105983168 CTGTGGACCACTAAAGAGCAAGG - Intergenic
935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG + Intergenic
936419589 2:112350474-112350496 CTGTGGACCAGTAAAGAGCAAGG - Intergenic
937251435 2:120526274-120526296 CTGTGGAACCACACTCAGCAGGG - Intergenic
937830813 2:126420995-126421017 TTGTGAACCAGCTCTGTGCAAGG + Intergenic
938062461 2:128263924-128263946 GTGTGGACCAGCCCTCAGCCTGG - Intronic
938703170 2:133897467-133897489 CTGTGGACCACTAAAGAGCAAGG + Intergenic
938938306 2:136146902-136146924 CTGTGAACCAGAACTGAGCCAGG - Intergenic
938976530 2:136483507-136483529 CTGTGGATCTGGTCTGAGCACGG + Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
941886487 2:170533144-170533166 TTGAGGACCATCACTGAGCACGG - Intronic
943408098 2:187514079-187514101 CCGTGGACCACTACAGAGCAAGG + Intronic
943747298 2:191475546-191475568 CTCTGGGGCAGCACTGAGCCTGG - Intergenic
944595281 2:201255492-201255514 CTGAGGAGCAGTACTGAGAATGG - Intronic
945289744 2:208115494-208115516 CTGTGGACCACTAAAGAGCAAGG + Intergenic
945427430 2:209723787-209723809 ATGTGGAACAGCAGTGAGAAAGG - Intronic
946559343 2:220895342-220895364 CTCTAGACCAGCACTGTGCCTGG + Intergenic
946741397 2:222805915-222805937 TTGTGGACATGCACAGAGCAGGG - Intergenic
946986532 2:225280096-225280118 CTGTGAACCAGGACTCAGCTGGG + Intergenic
948527710 2:238582366-238582388 CTGTGGACCAGAAGTCTGCAAGG + Intergenic
948813900 2:240499923-240499945 CTGTGGAGCAGAGCAGAGCAGGG + Intronic
948890062 2:240903239-240903261 CTGTGGGTCAGGACTGGGCAGGG + Intergenic
1168737903 20:159612-159634 CTGTGTACCAGCAGTGAACTGGG + Intergenic
1168824207 20:798379-798401 CTGTGGACCATTAAAGAGCAAGG + Intergenic
1169131848 20:3169954-3169976 GTGTAGGCCAGCACTGAGCCAGG + Intronic
1170339477 20:15307277-15307299 CTGTGGACCAGCTATGACCACGG + Intronic
1171461558 20:25300839-25300861 CTGAGCACCAGCACTGAGCCTGG - Intronic
1172009292 20:31837106-31837128 AGCTGGACCAGGACTGAGCAAGG + Intergenic
1172223202 20:33287634-33287656 CTGTGGACCAGCTCTGGCCTGGG - Intronic
1173545489 20:43894665-43894687 TGGTGGTCCAGCACTGAGCCTGG - Intergenic
1175589606 20:60178038-60178060 ACGTGTACCAGGACTGAGCATGG + Intergenic
1176125930 20:63474613-63474635 CTGTGGATCAGCCCTGACCTTGG - Intergenic
1176811278 21:13540716-13540738 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1179670876 21:42946794-42946816 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1180609748 22:17087476-17087498 CTGTGCTCCAGCACTGAGCTAGG - Intronic
1180693869 22:17739649-17739671 CTGAGTACCAGCGCTGAGCTGGG + Intronic
1181027294 22:20133332-20133354 CTGGGGACCAGCACTGGGCTGGG - Intronic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1182144013 22:27985631-27985653 CTATGGACCAGAACTCAGTAAGG + Intronic
1184384527 22:44166713-44166735 CGCTGGGCCAGCACTGGGCAGGG + Intronic
1185050015 22:48549376-48549398 CTGGTGGTCAGCACTGAGCAGGG + Intronic
1185163449 22:49243508-49243530 CTCTGGACCAGGCCTGAGCGAGG - Intergenic
1185284236 22:49993289-49993311 CTGTGGCCCAGATGTGAGCAGGG + Intergenic
949610940 3:5702794-5702816 CTGTGGACCACTAAAGAGCAAGG - Intergenic
949931394 3:9081212-9081234 CAGGGGACCAGCACTGGGGAGGG - Intronic
949979741 3:9494603-9494625 CCGTGAACCAGCAGTGGGCAAGG - Intergenic
950594284 3:13965196-13965218 CTGTGGACCACTAAAGAGCAAGG - Intronic
951248544 3:20368019-20368041 CTGTGGACCACTACAGAGCAAGG - Intergenic
952925192 3:38315166-38315188 CGGTGGTACAGCCCTGAGCAGGG + Intronic
954420507 3:50416578-50416600 CTGGGGCCCAGGACAGAGCAGGG - Intronic
954604749 3:51900667-51900689 CTGTGGACCACTAAAGAGCAAGG + Intronic
954710578 3:52503367-52503389 CACTGGGCCAGCAGTGAGCAGGG - Exonic
955584489 3:60462019-60462041 CTGTGTACCAGCACTGAGTCAGG - Intronic
955806399 3:62740078-62740100 CTGTTGACCTAGACTGAGCATGG + Intronic
955812864 3:62809439-62809461 CTGTGGAAAAGCTCTGAGAAAGG - Intronic
959921263 3:111870846-111870868 CTGTGGACCACCAGTGTGCGGGG + Intronic
960913079 3:122668752-122668774 CTCTGCACTAGCAGTGAGCAAGG + Intergenic
961380973 3:126496372-126496394 CTATACACCAACACTGAGCAAGG + Intronic
961441831 3:126958003-126958025 CTGTAGACCAGCTCAGGGCAGGG - Intronic
962097377 3:132306356-132306378 CTGTGGACCACTAAAGAGCAAGG + Intergenic
962277075 3:134023578-134023600 CTGTGGACCACTAAAGAGCAAGG + Intronic
962898329 3:139735722-139735744 CTGAGGACAAACACTGTGCAAGG + Intergenic
962905417 3:139797117-139797139 CTATGCACCAGCACTGTGCTGGG + Intergenic
962920357 3:139944629-139944651 CTGTTGCCCAGCACTGTCCAAGG + Intronic
964632369 3:158825698-158825720 CAAAGGACCAGCACTGAGAAAGG + Intronic
964933010 3:162048563-162048585 CTGTGGACCACTAAAGAGCAAGG - Intergenic
965689424 3:171339557-171339579 CTGTGTACCAGCACTGTGCTGGG - Intronic
965906077 3:173708354-173708376 CCGTGGTGCAGCACTGAGCTGGG - Intronic
966755544 3:183367972-183367994 TGGTGGAACAGCACTGAGCCAGG + Intronic
966891344 3:184409643-184409665 CTGAGGCCCAGCCCTGGGCACGG - Intronic
970092597 4:12427163-12427185 CTGTGGACCACCAAAGAGCAAGG - Intergenic
972991218 4:44824152-44824174 CTGTGGACCACTAAAGAGCAAGG - Intergenic
973900767 4:55468375-55468397 CTGTGGCACAGCACCTAGCATGG + Intronic
975205649 4:71641939-71641961 CTGTGGACCACTAAAGAGCAAGG + Intergenic
975536890 4:75460410-75460432 CTATGGACAAGCACTGTTCAAGG - Intergenic
976702407 4:87985602-87985624 CTGTGGACCAGCTCTGACTCAGG - Intergenic
976869088 4:89768805-89768827 CTATGGACCAGTACTGGTCATGG + Intronic
977565093 4:98572425-98572447 CTGTGTACCAGCACTGTTCTAGG + Intronic
977769522 4:100841159-100841181 CTATGGAGCTGCACTTAGCAAGG - Intronic
977972383 4:103227398-103227420 CTGTGGACCACTAAAGAGCAAGG + Intergenic
978314186 4:107417735-107417757 CTGTGGACCACTAAAGAGCAAGG + Intergenic
980073007 4:128263613-128263635 CTGTGGACCACTAAAGAGCAAGG + Intergenic
981869082 4:149464697-149464719 CTGTTGAGTAGCACTGATCATGG - Intergenic
983251851 4:165354485-165354507 CTGTGGACCAGTACCCATCATGG - Intergenic
983708446 4:170686785-170686807 CTGTGGACCACTAAAGAGCAAGG + Intergenic
983864987 4:172755515-172755537 TTGTGAACCAGCAGTGTGCAAGG - Intronic
983897980 4:173102200-173102222 CTGTGGACCACTAAAGAGCAAGG + Intergenic
984879360 4:184396975-184396997 CTGTACCCAAGCACTGAGCATGG + Intronic
986614793 5:9605031-9605053 CTTTGGACCTGGACTGAGCTTGG + Intergenic
989613521 5:43317367-43317389 CTGTGGACCACCAAAGAGCAAGG - Intergenic
989804532 5:45586933-45586955 CTGTGGGCCATCACTAACCAAGG + Intronic
991046091 5:62224248-62224270 CTGTGTCCCAGCACTGCTCATGG - Intergenic
991131925 5:63132418-63132440 CTCTGAAGCAGCAGTGAGCAGGG + Intergenic
991306085 5:65177587-65177609 CTGTGGACCACTAAAGAGCAAGG + Intronic
991618189 5:68518289-68518311 CAGTGGACCAGCACAGAGTTTGG - Intergenic
992774267 5:80076148-80076170 CTTTAGACCAGCACTGAGCCCGG + Intronic
998445718 5:142196950-142196972 CTGGGACTCAGCACTGAGCATGG - Intergenic
999309970 5:150545586-150545608 CTGTGTGCCAGCCCTGAGCCAGG + Intronic
1001193404 5:169650967-169650989 TTGTGGACAGGCACTGGGCAGGG + Intronic
1001865969 5:175105674-175105696 ATGTGGACCACCACTTATCATGG + Intergenic
1001999351 5:176188964-176188986 CTGATGCCCTGCACTGAGCAAGG + Intergenic
1002081916 5:176742423-176742445 CTGTGTCCCAGCACTGAGAATGG - Intergenic
1003504566 6:6729137-6729159 CTGTGGACCAGCCCTGACTACGG + Intergenic
1005339145 6:24827261-24827283 CACTGTACCAGCACGGAGCATGG - Intronic
1007241194 6:40426446-40426468 CTTTGGACCAGGACTTACCAAGG + Intronic
1007446115 6:41907406-41907428 CTGTGGACCAATACTGTGCTAGG - Intronic
1008123476 6:47644129-47644151 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG + Intergenic
1009757121 6:67954291-67954313 CTGAGGAACACCACTGAGCCTGG + Intergenic
1015171934 6:130263897-130263919 CTGTGGACCACTAAAGAGCAAGG + Intronic
1017947209 6:159105274-159105296 CTGAGGAGCAGCTCTGAGCCAGG + Intergenic
1018191372 6:161311832-161311854 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1018268827 6:162054564-162054586 CAGTGGCCCAGCACAGAGCAAGG + Intronic
1019487598 7:1296469-1296491 CTGTGGGCCAGGCCTGAGCTGGG + Intergenic
1019621773 7:1996017-1996039 ATGAGGACCAGCACTGACGAGGG + Intronic
1020043884 7:5025216-5025238 CTGTGGACCACTAAAGAGCAAGG - Intronic
1021849350 7:24792288-24792310 CTGTGGACCATTAAAGAGCAAGG - Intergenic
1023160132 7:37288879-37288901 CTATGGCCAAGCACTTAGCAGGG + Intronic
1023436335 7:40144025-40144047 CTGTGGACCACTAAAGAGCAAGG - Intronic
1023799114 7:43818112-43818134 CTGTGGACCACAAAAGAGCAAGG + Intergenic
1024025845 7:45409426-45409448 CTGTGGAACAGCACTGGTCCTGG + Intergenic
1024210707 7:47200804-47200826 CTCTGGGCCTGCAATGAGCATGG + Intergenic
1024812951 7:53235032-53235054 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1024910232 7:54439042-54439064 CTGTTGACCAGAAATAAGCAAGG + Intergenic
1025013897 7:55423359-55423381 CTGTGGACCATCACTCACCCAGG + Intronic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1028455910 7:91037978-91038000 CTGGGGTCCTGCACTGTGCATGG + Intronic
1029822076 7:103156210-103156232 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1030150462 7:106399275-106399297 CTGTCTGCCAGCATTGAGCAGGG + Intergenic
1030373037 7:108721840-108721862 CTGTATACCAGGACTCAGCAAGG - Intergenic
1031555723 7:123173753-123173775 CTGTGTACCAGCACTATGCTAGG - Intronic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032491364 7:132326860-132326882 CTGAGTACCAGCTCTGAGCCAGG - Intronic
1033097533 7:138443834-138443856 CTGTGAACCACCAAAGAGCAAGG - Intergenic
1034627461 7:152504397-152504419 CTGAAGAGCAGCAATGAGCAAGG - Intergenic
1035097672 7:156368660-156368682 CTGGGGACAAGCAGTGAGCGAGG - Intergenic
1035415711 7:158683847-158683869 CTGTTGACAAGGGCTGAGCAAGG + Intronic
1036412226 8:8512803-8512825 CTGTGGCCCATCACTGTGAAGGG - Intergenic
1036722384 8:11188776-11188798 CTGTGGACTTGCACAGGGCAGGG - Intronic
1036749702 8:11436031-11436053 CTGGGGACCCGCCCTGAGCCAGG - Intronic
1036949470 8:13127620-13127642 CTGTGGGGCAGCACCGTGCATGG + Intronic
1038383692 8:27120802-27120824 CTGTCTACCTGCACTCAGCAGGG + Intergenic
1038517887 8:28202710-28202732 CCCTGGACCAGCACTGGGCCCGG - Intergenic
1040993392 8:53376127-53376149 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1041227142 8:55711993-55712015 CTGTGGACCACTAAAGAGCAAGG + Intronic
1041480054 8:58310089-58310111 TAGTGGACCATCACTGAGCAAGG - Intergenic
1048507148 8:135031825-135031847 CTGAGGATCAGCACTGATTAAGG - Intergenic
1049370944 8:142266638-142266660 CTGTGGAACAGCACAGAGAAAGG - Intronic
1049374946 8:142284967-142284989 CTGTGTAACAGCACTGAGCATGG + Intronic
1049474108 8:142788988-142789010 CAGTGAACAAGCACTGGGCAGGG - Intergenic
1049632856 8:143668236-143668258 CTGTGGACCAGCTCTGGCTACGG + Intergenic
1052508093 9:29380847-29380869 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1053110733 9:35457559-35457581 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1056840299 9:89993219-89993241 CTGTGCTCCAGCCCTGGGCACGG - Intergenic
1057255355 9:93542219-93542241 ATGTGTAGCAGCACTGGGCAAGG + Intronic
1057530255 9:95838709-95838731 CTGGGGACCAGCAGTTTGCAAGG - Intergenic
1058006531 9:99922121-99922143 CTGTGGCCCAGTACTGTGTAAGG - Intronic
1058072050 9:100611162-100611184 CTTTGAACCAGCACTGATCCAGG - Intergenic
1058141232 9:101358427-101358449 CTGTGTCCCTGCTCTGAGCAGGG - Intergenic
1059528858 9:115017648-115017670 CTGTGGCCCAGCACCACGCAGGG - Intergenic
1060416324 9:123433109-123433131 CTGTGTGCCAGCGCTGAGCTCGG + Intronic
1060752687 9:126183854-126183876 CTGTGGGCCTGCCATGAGCATGG - Intergenic
1061303932 9:129722020-129722042 CTGTGTCCCAGCACTGAGCTGGG + Intronic
1061454082 9:130684478-130684500 CTGTGGGCCAGCCCTGGGCTTGG + Intergenic
1061631408 9:131874429-131874451 CTGTGGCTCAGCACTGGGTACGG + Intronic
1062008749 9:134255942-134255964 CTGTGGACGGGCACTCAGTAGGG + Intergenic
1062390208 9:136330848-136330870 CTGTTGACGAGGACTGGGCAAGG + Intronic
1187102876 X:16212927-16212949 CTGTGGCCCAGCTCTGGTCAGGG + Intergenic
1187662517 X:21565583-21565605 CAGAGGACCAGCACAGAGTAAGG + Intronic
1190534555 X:51412628-51412650 CAGTGGACCTGCACTGGACATGG + Intergenic
1190771224 X:53516401-53516423 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1191639243 X:63412667-63412689 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG + Intronic
1191882421 X:65856416-65856438 TGTTGGACCAGCAGTGAGCAAGG + Intergenic
1191917971 X:66222594-66222616 CTGTGGACCACTAGAGAGCAAGG - Intronic
1192145983 X:68683044-68683066 CGCTGGACCAGCCCTGTGCATGG + Intronic
1192311983 X:70024360-70024382 CTGAGGGCCTGAACTGAGCAAGG + Intronic
1192915462 X:75646678-75646700 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1194352302 X:92835287-92835309 CTGTGGACCCACACAGAGCCAGG + Intergenic
1195846844 X:109238091-109238113 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1195892569 X:109711888-109711910 CTGTGAACCAGTACTGTGCTAGG - Intronic
1196422991 X:115541711-115541733 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1196460075 X:115920497-115920519 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1196462072 X:115942116-115942138 CTGTGGGCAAGCACTGACCAGGG + Intergenic
1197728862 X:129793916-129793938 CTGAGGACTGGCACTGAGCCTGG + Exonic
1198662997 X:138991040-138991062 CTGTGGGCCTGCACTGGGCCTGG - Intronic
1198742483 X:139855914-139855936 CTGTGGACCACTAAAGAGCAAGG + Intronic
1199278624 X:145974300-145974322 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1199496266 X:148455905-148455927 CTTTGGTCCACTACTGAGCATGG - Intergenic
1200660611 Y:5952025-5952047 CTGTGGACCCACACAGAGCCAGG + Intergenic