ID: 1191722373

View in Genome Browser
Species Human (GRCh38)
Location X:64243932-64243954
Sequence CCTGTTCAACAAACAGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191722373_1191722379 28 Left 1191722373 X:64243932-64243954 CCTAGCACTGTTTGTTGAACAGG No data
Right 1191722379 X:64243983-64244005 CAACTTTGCCGAAGATTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191722373 Original CRISPR CCTGTTCAACAAACAGTGCT AGG (reversed) Intergenic
No off target data available for this crispr