ID: 1191722731

View in Genome Browser
Species Human (GRCh38)
Location X:64248298-64248320
Sequence CTGCCAGCAGGAGTATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191722731_1191722736 -8 Left 1191722731 X:64248298-64248320 CCTGTGCATACTCCTGCTGGCAG No data
Right 1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG No data
1191722731_1191722737 -7 Left 1191722731 X:64248298-64248320 CCTGTGCATACTCCTGCTGGCAG No data
Right 1191722737 X:64248314-64248336 CTGGCAGTGGGCCACAGGCAGGG No data
1191722731_1191722742 30 Left 1191722731 X:64248298-64248320 CCTGTGCATACTCCTGCTGGCAG No data
Right 1191722742 X:64248351-64248373 GCCTGTGCTTGCACTTATGCTGG No data
1191722731_1191722739 -1 Left 1191722731 X:64248298-64248320 CCTGTGCATACTCCTGCTGGCAG No data
Right 1191722739 X:64248320-64248342 GTGGGCCACAGGCAGGGGAAAGG No data
1191722731_1191722738 -6 Left 1191722731 X:64248298-64248320 CCTGTGCATACTCCTGCTGGCAG No data
Right 1191722738 X:64248315-64248337 TGGCAGTGGGCCACAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191722731 Original CRISPR CTGCCAGCAGGAGTATGCAC AGG (reversed) Intergenic
No off target data available for this crispr