ID: 1191722736

View in Genome Browser
Species Human (GRCh38)
Location X:64248313-64248335
Sequence GCTGGCAGTGGGCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191722731_1191722736 -8 Left 1191722731 X:64248298-64248320 CCTGTGCATACTCCTGCTGGCAG No data
Right 1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191722736 Original CRISPR GCTGGCAGTGGGCCACAGGC AGG Intergenic
No off target data available for this crispr