ID: 1191724885

View in Genome Browser
Species Human (GRCh38)
Location X:64268895-64268917
Sequence CTGAATACCCTGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191724885_1191724890 12 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1191724885 X:64268895-64268917 CCATTCTCCATCAGGGTATTCAG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1191724890 X:64268930-64268952 ACCCATAAAGCCAAGAGGATTGG 0: 1
1: 0
2: 1
3: 17
4: 158
1191724885_1191724889 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1191724885 X:64268895-64268917 CCATTCTCCATCAGGGTATTCAG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1191724889 X:64268925-64268947 TTGATACCCATAAAGCCAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 94
1191724885_1191724893 19 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1191724885 X:64268895-64268917 CCATTCTCCATCAGGGTATTCAG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1191724893 X:64268937-64268959 AAGCCAAGAGGATTGGTCAAAGG 0: 1
1: 0
2: 0
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191724885 Original CRISPR CTGAATACCCTGATGGAGAA TGG (reversed) Exonic
907889970 1:58627460-58627482 CAGCAAACCCTGAGGGAGAAGGG - Intergenic
908267680 1:62395117-62395139 CTGTCTTCCCTGATGGAGACAGG + Intergenic
909506706 1:76399379-76399401 CTGAATAACCTCATGGAAAAAGG - Intronic
910735072 1:90444768-90444790 CTGAATATTCTGACTGAGAATGG + Intergenic
912207919 1:107528427-107528449 CTGAATGACCTCATGGAGTAGGG + Intergenic
912683179 1:111741647-111741669 CTGACTACCGTGCTGGAGACTGG - Intronic
913438348 1:118870845-118870867 TAGAATGCCCTGATGGAGAGTGG - Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
914957184 1:152173266-152173288 ATGAAGACCCAGATAGAGAAAGG - Intergenic
915714653 1:157933292-157933314 CTGAATAGCCTAATCAAGAAAGG - Intergenic
916009731 1:160693835-160693857 CTGAAAACCCTGAGGAACAAAGG - Intronic
916502212 1:165396692-165396714 CTGTATACCCTGAAGGGGTAGGG + Intergenic
917178555 1:172266619-172266641 CTAAATACCCTGATTCAGGAAGG + Intronic
917194355 1:172450040-172450062 CGCTATACCCTGCTGGAGAATGG - Intronic
917658386 1:177151580-177151602 CTGAATAACTTCATGGAGTAGGG + Intronic
920629637 1:207639004-207639026 CTGAAAACCCTGAGGAACAAAGG + Intronic
921555328 1:216591856-216591878 ATGAATAAGCTGATGGGGAATGG + Intronic
921816925 1:219574746-219574768 CTGAGTACCCTGAAGGAGCTTGG - Intergenic
1063530927 10:6830626-6830648 CTGAAAACCCTGAGGAACAAAGG + Intergenic
1063918490 10:10908543-10908565 ATAAATACACTGTTGGAGAAAGG + Intergenic
1064330073 10:14385384-14385406 GAGAAAACCCTGATGCAGAAGGG + Intronic
1065978074 10:30861153-30861175 CTCAAAACCCTGATGTAAAATGG + Intronic
1068210686 10:53915996-53916018 CTGAAGTCCCTGATAGAAAATGG + Intronic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1075418252 10:122281558-122281580 TTAAATACCCTGATGGAGCCTGG - Intronic
1075654374 10:124151699-124151721 CAGAAGACCCTGATGGAAACGGG + Intergenic
1077382741 11:2252376-2252398 CTAAGGACCCTAATGGAGAAGGG + Intergenic
1079251498 11:18791150-18791172 CTGAAGCCCCTGAGGGAGATTGG - Intronic
1080358807 11:31488436-31488458 CTGAATTCTCTGATGGATAAAGG - Intronic
1083394385 11:62379796-62379818 CTGAAAACCCTGAGGAACAAAGG + Intronic
1084811830 11:71616646-71616668 CTGAATACCCTGGGAGAGAGAGG - Intergenic
1084847677 11:71913056-71913078 CTGAATACCCTGGGAGAGAGAGG - Intronic
1086753162 11:90525312-90525334 ATGAGTACCATGATGCAGAAAGG + Intergenic
1088495612 11:110429087-110429109 ATGAGTACCCTGATGGAGGAAGG + Intergenic
1092513932 12:9187935-9187957 CTGAAAACCCTGATGGGGGTGGG + Intronic
1094874566 12:34626423-34626445 CTGAAAACCCTGAGGAACAAAGG + Intergenic
1095521788 12:43075344-43075366 CTGCCTGTCCTGATGGAGAAGGG - Intergenic
1096699486 12:53372708-53372730 TTGAAGGCCCTGAAGGAGAAAGG - Intergenic
1097490571 12:60264478-60264500 CTGGATAGCCTGCTGGATAATGG - Intergenic
1097952455 12:65447073-65447095 CTGAATACCTCAATGGGGAATGG - Intronic
1099489133 12:83267010-83267032 TTAAGTACCCTGAAGGAGAATGG + Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1106576042 13:30976639-30976661 CTCAAGGCCCTGATGGAGTATGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114189254 14:20428617-20428639 CTGAATACCCAGGTGAGGAAAGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114784256 14:25576721-25576743 GCCAATACCCTGATGGAGTAAGG - Intergenic
1116495528 14:45555171-45555193 CTGATTACCCTCCTGGAAAAGGG - Intergenic
1117755495 14:58970470-58970492 TTGAAAGCCCTGCTGGAGAAGGG - Intergenic
1118067954 14:62212519-62212541 CTGAATACCCTGTTCAAGAGTGG - Intergenic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1124454408 15:29827280-29827302 CTGAATGCCCTGCTGGGGACAGG - Intronic
1128618965 15:69132742-69132764 CTGATAATCCTGATGGAGACAGG - Intergenic
1130265768 15:82401665-82401687 CTTAATCCCATGAAGGAGAAAGG + Intergenic
1130506246 15:84545250-84545272 CTTAATCCCATGAAGGAGAAAGG - Intergenic
1131335670 15:91546411-91546433 TTGCATACCCCGATGGAGTAAGG + Intergenic
1131830008 15:96348078-96348100 CTGAAGTCCCCGCTGGAGAAGGG - Intergenic
1133202034 16:4209565-4209587 GTGGGTACCCTGAGGGAGAAGGG - Intronic
1134182647 16:12060288-12060310 CTGAAGTCCCTGATGTAAAACGG - Intronic
1140683899 16:77414141-77414163 CTGAATACTCTGATGTGGACAGG - Intronic
1146260017 17:31415006-31415028 CTGCTTCCCCTGCTGGAGAAGGG - Intronic
1147203539 17:38820580-38820602 CTGATAACCGTGATGGAGGATGG - Intronic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1150913571 17:69413501-69413523 CACAGCACCCTGATGGAGAACGG - Intergenic
1152494508 17:80661468-80661490 CTCAACACCGTGGTGGAGAAGGG - Intronic
1152734564 17:81991123-81991145 CTGAAGACCGTGAGGGAGCAGGG + Intronic
1153169971 18:2304476-2304498 CTTAATACCTTGTTGAAGAACGG - Intergenic
1153778283 18:8472837-8472859 AAGAATTCCCTGATGAAGAAAGG - Intergenic
1154988938 18:21581650-21581672 CTAAATTCCCTGATGGATTAGGG - Intronic
1156145229 18:34167209-34167231 CTCAATTCCCTGATAGAAAATGG - Intronic
1159485070 18:69045053-69045075 TTGAATACCCTACTGGAGTAGGG + Intronic
1159599388 18:70414149-70414171 CTCAAGACCCTGATGGAGTTTGG - Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160026245 18:75219060-75219082 GTGAATACCTTCATGGTGAAGGG + Intronic
1160149534 18:76388565-76388587 TTGATGACCCAGATGGAGAAAGG + Intronic
1163920029 19:20279667-20279689 CTGAAAACCCTGAGGAACAAAGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165442991 19:35841556-35841578 CTGAAAATCCTAATGGAGACTGG - Intronic
1165606839 19:37113051-37113073 CTGAAAACCCTGAGGAACAAAGG + Intronic
1168680201 19:58309669-58309691 CTAAAAGTCCTGATGGAGAATGG - Intronic
924995171 2:353959-353981 CTGAATGCCCTATTGGAGACGGG - Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
927853399 2:26513670-26513692 TTGAATACCCTGATCTATAAGGG + Intronic
929629656 2:43446440-43446462 CTGACTACCCTGCTAGAGAGAGG + Intronic
930641036 2:53854655-53854677 CTGAAGACCCTCCTGGAGAGAGG + Exonic
931117138 2:59177119-59177141 CTGAAAAACTTGATGGTGAAAGG + Intergenic
931128065 2:59299484-59299506 CAGAAAACACTGATAGAGAATGG + Intergenic
931494961 2:62795494-62795516 CTTAAGAACCTTATGGAGAAAGG - Intronic
932508212 2:72257627-72257649 CAGAATATCCTTATGGAGACAGG + Intronic
933592368 2:84247250-84247272 GTAAATACCCTGATGAGGAATGG - Intergenic
934774303 2:96927388-96927410 CTGAATCCTCTGATGGGAAATGG + Intronic
935261907 2:101362908-101362930 CTGAGGACCCTGGTGGAGAGTGG + Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
937324786 2:120984077-120984099 CTGATTTCTCTGATGAAGAAAGG - Intronic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937436232 2:121884282-121884304 CTCAATACCCTGATGCCAAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938575765 2:132602697-132602719 CTGAATAATCTGATGTAAAATGG + Intronic
941639123 2:167968682-167968704 CTGAATAGATTGATGCAGAAAGG + Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942858601 2:180582662-180582684 CTGATTAGCCTGCTGGAGGAAGG - Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
944667937 2:201972359-201972381 GTGACTACCCTGAGTGAGAAGGG + Intergenic
948497622 2:238362585-238362607 GTAAATATCCTGAAGGAGAAGGG - Intronic
1169198197 20:3694490-3694512 CTCACTACCCTGATGGACACAGG - Exonic
1170507236 20:17039849-17039871 CTGAAAGTCCTGATGTAGAAAGG - Intergenic
1170835559 20:19881370-19881392 GTAAACACCCTGATGGTGAAGGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173828419 20:46062388-46062410 CTGGATACCCTGATCCAGAGTGG - Exonic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1183678095 22:39310982-39311004 CCGAAGACCCTGATGCAGAAAGG + Intergenic
1184762599 22:46553172-46553194 CTGACCAGCCTGATGGAGAGGGG + Intergenic
950030759 3:9851583-9851605 CTGAAAACCCTGAGGAACAAAGG + Intronic
950662551 3:14475574-14475596 CTGAAGAGGCTGGTGGAGAAGGG + Intronic
951471712 3:23063590-23063612 CTTCAGACCCTGTTGGAGAAGGG - Intergenic
952158732 3:30671919-30671941 CTGGACACCCTGGTGGGGAAAGG + Exonic
952284356 3:31953921-31953943 CTGAACTCTCTGATGGAAAAAGG - Intronic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
956736572 3:72243221-72243243 CTGACCACCCTGAGAGAGAATGG - Intergenic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
957806953 3:85160164-85160186 CTGAAAACCCTCATTTAGAAAGG - Intronic
959021576 3:101192978-101193000 CTGAATACCCTGACCCAGAAAGG + Intergenic
961600985 3:128061915-128061937 CTCAATGCCCTGCTGCAGAATGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962498844 3:135968467-135968489 GTGAATACCTTGAGGAAGAAAGG + Intronic
964386163 3:156150171-156150193 CTGAATAGGCTGCTGGTGAAGGG + Intronic
964465441 3:156986569-156986591 CTGTCTACCCTGATGCAAAAAGG - Intronic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966008877 3:175051672-175051694 CTAATTACACTTATGGAGAAGGG + Intronic
966287708 3:178317087-178317109 TTGAATACCCTCATAGTGAATGG + Intergenic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
968376113 4:42945-42967 CTGAACACCCTAATGGAGAGTGG - Intergenic
971040114 4:22742563-22742585 CTAAATACCCAGAAGCAGAATGG + Intergenic
974125088 4:57686218-57686240 TTAAATACCCTGATGGTAAAAGG - Intergenic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982452555 4:155570363-155570385 CTGAATCCCATGATTAAGAATGG + Intergenic
982866665 4:160521767-160521789 TTAAATACCATGATGTAGAAGGG - Intergenic
983215496 4:164998663-164998685 CTGAAAACCCTGAGGAACAAAGG - Intergenic
983772421 4:171568899-171568921 CTAAATACCTTTATGGGGAAAGG + Intergenic
983784603 4:171715740-171715762 CTGAACACCCTGCTGTGGAAAGG + Intergenic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987654689 5:20791573-20791595 CTGAATAACCACGTGGAGAAGGG - Intergenic
988740949 5:34070268-34070290 CTGAATAACCACGTGGAGAAGGG + Intronic
991430186 5:66536413-66536435 TTGAATACCATGTTTGAGAAAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
994835419 5:104845904-104845926 CTGGATTCCCTGATGCAGAAAGG + Intergenic
995195955 5:109368722-109368744 CTGAATGCAGTGATGGGGAATGG - Exonic
995677674 5:114681469-114681491 CAGAATTCCCTGATGGAGCCTGG + Intergenic
995678160 5:114686439-114686461 CAGAATTCCCTGATGGAGCCTGG - Intergenic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
1003436289 6:6091367-6091389 CTAAATACCCTAATGCAGCAAGG - Intergenic
1005485073 6:26291944-26291966 CTAAAAATCCTGATGGAGAATGG + Intergenic
1008749462 6:54714872-54714894 CTGAACTACCTAATGGAGAAGGG - Intergenic
1012585606 6:100918529-100918551 CTGAAAACCCTCATGGGGTAAGG - Intergenic
1012676399 6:102118470-102118492 CTGGCTACCATGATGAAGAATGG + Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1013504186 6:110782744-110782766 GTGTTTAACCTGATGGAGAAAGG - Intronic
1015073920 6:129131930-129131952 CAGAAGAACGTGATGGAGAAGGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016580790 6:145627636-145627658 CTGCATGCGCTGCTGGAGAAGGG - Exonic
1016751806 6:147638473-147638495 TTGAAAACCCTGATGAGGAATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1024224856 7:47318712-47318734 CTGATTATCATGATGGAGAATGG + Intronic
1026166405 7:67913835-67913857 CAGGCTACCCTGATGAAGAATGG - Intergenic
1031366091 7:120902009-120902031 TTAAATGACCTGATGGAGAATGG + Intergenic
1032436593 7:131905968-131905990 TTGAGTTCCCTGATGGAGCATGG - Intergenic
1033269208 7:139915587-139915609 CTGGACAGCCTGGTGGAGAAGGG + Intronic
1034055220 7:148027220-148027242 CTGAATAGGCCTATGGAGAAAGG - Intronic
1034132061 7:148728220-148728242 CGGACAACACTGATGGAGAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035340592 7:158158330-158158352 CTGAAAACCCTCACAGAGAAGGG - Intronic
1041744790 8:61197026-61197048 CTGAAACCCCTGATTGAGAAAGG - Intronic
1043586892 8:81780475-81780497 ATGAATATCCTGATGGAGCTAGG + Intergenic
1045702230 8:104880358-104880380 AAGAATACCCTGAAAGAGAATGG - Intronic
1046759887 8:118010043-118010065 ATGAAGACACTGATGGACAAAGG - Intronic
1046897246 8:119486217-119486239 CAGATTTCCCTGTTGGAGAAAGG - Intergenic
1048736595 8:137508906-137508928 CTGAATTCCCTGCTGAAGGATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1052138255 9:24942880-24942902 CTCAATCACCTGATAGAGAAGGG + Intergenic
1052897239 9:33759271-33759293 CTGACTACCCTACTGGAGGATGG - Intronic
1053611978 9:39723138-39723160 CTGTATACCATGCTGCAGAAGGG - Intergenic
1053870016 9:42481132-42481154 CTGTATACCATGTTGCAGAAGGG - Intergenic
1054086276 9:60748017-60748039 CTGTATACCATGCTGCAGAAGGG + Intergenic
1054241541 9:62619255-62619277 CTGTATACCATGCTGCAGAAGGG + Intergenic
1054555667 9:66653778-66653800 CTGTATACCATGCTGCAGAAGGG + Intergenic
1056964626 9:91155389-91155411 CTGACTGCCCTGATCGAGCATGG - Intergenic
1061990324 9:134155190-134155212 CTCCTTACCCTGATGGGGAAGGG + Intronic
1203340125 Un_KI270320v1:4008-4030 CTGAAGACTTTGATGGAAAAGGG + Intergenic
1203573112 Un_KI270744v1:151205-151227 CTGAACACCCTAATGGAGAGTGG + Intergenic
1190339632 X:49286399-49286421 CCGAAGACCCTGATGATGAAGGG + Exonic
1190509522 X:51161798-51161820 GTGAAGACCCTGAGCGAGAATGG + Intergenic
1191714914 X:64187570-64187592 CTCCAGACCCTGCTGGAGAAGGG - Exonic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1193047189 X:77065917-77065939 CAGAATGCTCTGGTGGAGAAAGG - Intergenic
1194026025 X:88752062-88752084 CTGAATTCCATGGTGGAGAAAGG - Intronic
1197161578 X:123329109-123329131 CTGAATACACTCTTGGAGGATGG - Intronic
1197202618 X:123761479-123761501 CTGAATAACCTTGTGGAGCAAGG - Intergenic
1197762451 X:130037475-130037497 CTGAACATCCTGCTGGAGCACGG + Exonic
1198372633 X:136005752-136005774 CAGAAAACCCTGTTTGAGAAAGG - Intronic
1198862880 X:141089424-141089446 CTGAAAAGCTTGATGTAGAAAGG + Intergenic
1198899813 X:141497965-141497987 CTGAAAAGCTTGATGTAGAAAGG - Intergenic
1199727206 X:150595697-150595719 CTGAATAACCTGAAAGACAATGG + Intronic
1200779692 Y:7203265-7203287 CTGCATAGCCTGTTGGAGAAAGG + Intergenic
1201476330 Y:14385925-14385947 TTGAATAACCTGAAGCAGAAAGG - Intergenic
1202363730 Y:24139364-24139386 CTTAATCCCATGAAGGAGAAAGG + Intergenic
1202507050 Y:25530753-25530775 CTTAATCCCATGAAGGAGAAAGG - Intergenic