ID: 1191725219

View in Genome Browser
Species Human (GRCh38)
Location X:64272065-64272087
Sequence GGCCCACAGAAGCTCTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191725219 Original CRISPR GGCCCACAGAAGCTCTGGCT TGG Intronic
900792181 1:4687984-4688006 GGCCCACAGAACCTCTCCCTGGG + Intronic
900992201 1:6103266-6103288 GGCCCAAAGGAGCCCTGGCCAGG + Exonic
901137376 1:7006735-7006757 AGCCCTCAGAGGCTCTGGGTTGG - Intronic
901437106 1:9253954-9253976 GGCCCACAGAAGCCCTGTAAGGG + Intronic
903212383 1:21825584-21825606 TGGCCACAGTAGCTCTGGCAGGG + Intronic
904090772 1:27943520-27943542 GGCCCCAAGAAGCTGTGTCTGGG - Intronic
906754159 1:48292893-48292915 TGCCCACAGAGGCGCTGGCTGGG + Intergenic
906830469 1:49026060-49026082 TGCCCCCATAAGATCTGGCTTGG + Intronic
907310651 1:53537172-53537194 GGACCCCTCAAGCTCTGGCTTGG + Intronic
908787296 1:67747917-67747939 GTCCCACAATAGCTCTGCCTTGG - Intronic
909698245 1:78491319-78491341 AGCCAGCAGAAGCTGTGGCTGGG - Intronic
911991946 1:104709611-104709633 GACCCCAAGAATCTCTGGCTAGG - Intergenic
915625782 1:157113317-157113339 GCCCCACAGGTGCTCTGTCTGGG - Intergenic
915973890 1:160372437-160372459 GGCTCCCAGCAGCTCTAGCTGGG + Exonic
916618031 1:166465332-166465354 GGCCCATAGAAGCTGTGGCCAGG - Intergenic
920036244 1:203067655-203067677 GCCCCACTGAGGCTCTGGCTTGG + Intronic
920044399 1:203124225-203124247 GGCACAGAGAAGCCCTGACTGGG + Intronic
921435240 1:215111913-215111935 GGCCCACAGAATCTCTAGGCAGG - Intronic
922984142 1:229852811-229852833 GGCCCCCACTAGCTCTGCCTTGG + Intergenic
923893216 1:238238765-238238787 GACCCAGAGAAGCTATGTCTGGG + Intergenic
1063389505 10:5640196-5640218 GGCCCACGGAAGGTCGGCCTGGG - Exonic
1065704458 10:28459361-28459383 GGCCCACAGGATCTCTAGTTGGG - Intergenic
1066155961 10:32678398-32678420 GACCCACACAAACTCTGGCTGGG - Intronic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067223029 10:44357444-44357466 TGCCCCCAGAGGTTCTGGCTCGG - Intergenic
1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG + Exonic
1067716606 10:48695280-48695302 GGCAGACAGCAGGTCTGGCTTGG + Intronic
1070022330 10:72599093-72599115 GCCAGACAGAAGCTCTGCCTGGG - Intronic
1071851334 10:89573412-89573434 CACTCACAGAAGCTCTGGGTTGG + Intergenic
1072834357 10:98695302-98695324 AGGCCACAGAAGCCCTGGCTTGG + Intronic
1073192126 10:101659087-101659109 GGACCAAAGCAGCCCTGGCTGGG + Intronic
1073249501 10:102113241-102113263 GGCACACACAGGCTCTGACTTGG - Intronic
1073906511 10:108287077-108287099 GGCCCCCAGAATCTCTGGCCAGG - Intergenic
1075506063 10:123023890-123023912 GGACCTCAGAACCTCTGCCTAGG + Intronic
1075969169 10:126638244-126638266 GGACCTCAGGAGCTCTGGATGGG + Intronic
1076217036 10:128703503-128703525 GACCCCCAGAAGCCATGGCTGGG + Intergenic
1076501472 10:130939708-130939730 GCCGGACAGAAGCTCAGGCTTGG + Intergenic
1077344048 11:2038281-2038303 GGCAGAGAGAAGCTCTGGCAGGG + Intergenic
1077404730 11:2377855-2377877 GGCCCCCAGAAGCCCCGGCCCGG - Intronic
1078156691 11:8805972-8805994 GGCCCTCAGAAGCACTGGAGGGG - Intronic
1078487433 11:11736910-11736932 GGCTCACAGAAGACGTGGCTGGG + Intergenic
1078855624 11:15204550-15204572 TGCCCACAGAGGCTCTGGTGAGG + Intronic
1079683976 11:23332626-23332648 GCCCCAGAGAAGCTCATGCTGGG - Intergenic
1081810282 11:45910482-45910504 GGCCCAGAGAAGCTCAGCCAGGG + Intronic
1083133113 11:60646047-60646069 GGCCCCAAGAATCTCTGGCTGGG - Intergenic
1083626094 11:64072825-64072847 GACCCTCAGACGCTCTGGTTGGG - Intronic
1083645475 11:64170041-64170063 GGCCCACAGAAGCAAAGGCGTGG + Intergenic
1084969040 11:72759642-72759664 GGAGCCCAGAAGGTCTGGCTGGG - Intronic
1085325738 11:75605346-75605368 GTGCCACAGAAGCTCAGCCTGGG - Intronic
1085780162 11:79400978-79401000 GGCCCTGAGAAGCTCTGATTGGG + Intronic
1087840425 11:102915067-102915089 GACCCCCAGAATCTCTAGCTGGG + Intergenic
1088413846 11:109567562-109567584 GGACCACAGAAACCATGGCTGGG - Intergenic
1091197508 11:133744591-133744613 GGCCCACTCAAGCCATGGCTGGG - Intergenic
1202827034 11_KI270721v1_random:93470-93492 GGCAGAGAGAAGCTCTGGCAGGG + Intergenic
1091692003 12:2603667-2603689 GACTCCGAGAAGCTCTGGCTTGG + Intronic
1092144610 12:6205832-6205854 GGACCACAGAAGCTGTGGTTGGG - Intronic
1093228733 12:16516588-16516610 GGCCCACAGAATTTCAGACTGGG - Intronic
1093613758 12:21195191-21195213 GGCCCACAGACGCTCTGCTGGGG - Intronic
1094257736 12:28454321-28454343 GGCCCACAAAATCTCTGATTAGG - Intronic
1094495226 12:30985078-30985100 GGCCCACAGATGATGTGGGTAGG - Intronic
1096476562 12:51912593-51912615 GGCCCAGATCAGCTCTGCCTGGG + Intronic
1098148010 12:67517339-67517361 CAGCCACAGAAGGTCTGGCTCGG + Intergenic
1098230207 12:68365401-68365423 GGCCCACAGGAAGTCTGGCCGGG + Intergenic
1101875726 12:108595955-108595977 GACCCACTCAAGTTCTGGCTGGG + Intronic
1102817133 12:115875633-115875655 GGCCAATGGAAGCTTTGGCTAGG - Intergenic
1104330788 12:127842855-127842877 TGCCCAGAGAAGCTCAGCCTGGG + Intergenic
1105604234 13:21913446-21913468 AGCCCACAGAAGGGCTGGCGAGG - Intergenic
1107603268 13:42034632-42034654 GCTCCATAAAAGCTCTGGCTGGG + Intergenic
1110876105 13:80512241-80512263 GGCCCAAGGAAGCTCTGCCTGGG - Intergenic
1111388940 13:87565342-87565364 GGCCCTCAGAATCTCTGGCTGGG + Intergenic
1112134589 13:96562881-96562903 GGCTCACAGAAGGTCAGGATAGG + Intronic
1112608467 13:100931323-100931345 GGCCCAGAGAAGCACTGGAATGG - Intergenic
1113256145 13:108508327-108508349 GGCCTCCAGAACCTCTAGCTGGG - Intergenic
1116153918 14:41178541-41178563 GGTCCACAGAACCTGTGTCTGGG + Intergenic
1121230824 14:92356709-92356731 GGCCCACTGAAGCTTTGTCCAGG - Intronic
1121797142 14:96744545-96744567 GGCCCACAGATCATCCGGCTTGG - Intergenic
1122251737 14:100444617-100444639 GGCCTGCAGAAGTTCTGGGTTGG + Intronic
1122296068 14:100706358-100706380 GGCCCACAGCTGCTCTAGCCTGG - Intergenic
1122907050 14:104806404-104806426 AGCCCACAGAGGCTCTGCCCTGG + Intergenic
1122962658 14:105103519-105103541 GGCCCCCAGAATCTTTGGCTTGG + Intergenic
1123716967 15:23040376-23040398 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717058 15:23040671-23040693 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717693 15:23042788-23042810 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718086 15:23044127-23044149 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718377 15:23045154-23045176 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718746 15:23046449-23046471 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718909 15:23047009-23047031 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719124 15:23047752-23047774 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719186 15:23047970-23047992 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1123719413 15:23048759-23048781 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1124643699 15:31419135-31419157 GGCCCCCAGAATCCCTAGCTGGG + Intronic
1126369313 15:47928995-47929017 GGCCCACATTAGCTGTGGCCAGG - Intergenic
1128977894 15:72166815-72166837 AGCCAACAGAAGCTCTGCCTAGG + Intronic
1129883825 15:79025233-79025255 GGCCCATAGACCCTCTGGCCAGG + Intronic
1130522007 15:84669854-84669876 CGCCCACACAAACTCTGGCATGG + Exonic
1130966585 15:88701711-88701733 GAGCCACAGATGCTTTGGCTTGG - Intergenic
1130988527 15:88860534-88860556 GGTCCACTGAGGCTCAGGCTGGG + Intronic
1131678260 15:94694013-94694035 GACCCACAGAGGCACTGACTTGG + Intergenic
1132805931 16:1775149-1775171 TGCCCACAGCAGGGCTGGCTGGG + Intronic
1133033796 16:3023791-3023813 GGGCCGCAGGAGCTTTGGCTGGG - Intronic
1134637590 16:15804032-15804054 GTCCAACACAAGCTCAGGCTTGG - Intronic
1137456435 16:48621462-48621484 GGCTCACTGAAGCTGTGTCTGGG + Intergenic
1141550954 16:84806455-84806477 TGCCTGCAGAAGCTCTGGCCAGG - Intergenic
1142686105 17:1577783-1577805 GGCGCACTGAGGCTCTGGATGGG + Intronic
1143044970 17:4070842-4070864 GGCCCACAGAAGTTCTGAGCAGG + Exonic
1144670496 17:17130094-17130116 GACCCACAGGACCTGTGGCTTGG + Intronic
1145790788 17:27625325-27625347 GGCCCACAGAAAGTCAGTCTGGG + Exonic
1146028100 17:29340578-29340600 GGCCCACAGAAACAGTGGCATGG - Intergenic
1146172638 17:30645514-30645536 CTCCCACAGGAGCTGTGGCTTGG + Intergenic
1146346093 17:32061523-32061545 CTCCCACAGGAGCTGTGGCTTGG + Intergenic
1146913531 17:36663593-36663615 GCCCCAGAGAAGCTCTGGGGGGG - Intergenic
1147385184 17:40076988-40077010 GGTCCAGAGGAGCCCTGGCTGGG - Intronic
1147544198 17:41387526-41387548 GGTCCCCAGTATCTCTGGCTGGG - Intronic
1147740668 17:42669584-42669606 GCTCCACAGAAGCTGTGCCTGGG - Exonic
1148734843 17:49859499-49859521 GTGCCACAGAAGCTGTAGCTTGG + Intergenic
1150245039 17:63668440-63668462 GGGCCAGAGACGCTGTGGCTAGG - Intronic
1150571933 17:66394214-66394236 GGCCCACAGAAGCTGTGACATGG + Intronic
1150600617 17:66647619-66647641 AGAGCACAGATGCTCTGGCTGGG + Intronic
1152032702 17:77853896-77853918 AACCCACAAAAGCCCTGGCTGGG - Intergenic
1152435518 17:80273960-80273982 GTCTCCCAGAAGCTGTGGCTGGG + Intronic
1155501760 18:26493229-26493251 GGCCATCAGAAGCTCTGGCAGGG + Intronic
1157221911 18:45834349-45834371 GACACTCAGAAGCTCTGGCAGGG - Intronic
1158287188 18:55896589-55896611 GGGCTTCAGAAGCTCTGACTTGG + Intergenic
1160564110 18:79776379-79776401 GCTGCACAGAAGCTCTGGCCAGG - Intergenic
1160792403 19:928745-928767 GGTCCAGAGAAGTTGTGGCTTGG + Intronic
1160942674 19:1627719-1627741 AGCCCACAGAAGCCCTGCCCAGG + Intronic
1161707550 19:5829231-5829253 GGCCCATAAAAGCCCTGGCCGGG + Intergenic
1162989798 19:14294566-14294588 CTCCCACAGGAGCTGTGGCTTGG - Intergenic
1166257935 19:41619470-41619492 GCCCCAGAGAAGCCCTGGGTGGG - Intronic
925129024 2:1481488-1481510 GACCCACAGAAGCTTTGCTTTGG + Intronic
926019365 2:9481827-9481849 GGTCCACAGAAGCTGGGGGTAGG + Intronic
927107724 2:19842172-19842194 GGCCCTCAGAAGCTGTGGACAGG + Intergenic
930096931 2:47572028-47572050 GGGCCACAAAAGTTCTGGCGTGG + Intergenic
930886657 2:56333965-56333987 GGTGCTCAGAAGCACTGGCTGGG - Intronic
932781074 2:74558832-74558854 GGGCCACAGTAGCTCGAGCTCGG + Exonic
934178828 2:89601591-89601613 GACCCAGAGAAGCTTTGCCTGGG - Intergenic
935465338 2:103389846-103389868 GGCCCAGAGAATCTCTCTCTGGG + Intergenic
935697552 2:105783271-105783293 GGCCCACCCAAGCTCTAGCGAGG - Intronic
937227292 2:120377239-120377261 GGCCCACAGAGGGTGTGGGTGGG - Intergenic
937345725 2:121124226-121124248 TGCACACAGCAGCCCTGGCTTGG + Intergenic
938178303 2:129156548-129156570 GGCCAGCAGAGGCTGTGGCTTGG - Intergenic
941176122 2:162199408-162199430 GGCTCATGGAAGCTCAGGCTGGG + Intronic
941535470 2:166718072-166718094 GGCCCCCAGAATCTCTGGCCAGG - Intergenic
948779556 2:240310369-240310391 GACCCTCTGAATCTCTGGCTGGG + Intergenic
1169415436 20:5412096-5412118 GATCCCCAGAAGCTCTGTCTGGG - Intergenic
1170412249 20:16104345-16104367 GACCCACAGCAGCACTGTCTGGG - Intergenic
1171210188 20:23310679-23310701 GCCCCAGAGAAGCTGTGGGTGGG - Intergenic
1172696866 20:36828971-36828993 GGCTCACAGAGACACTGGCTTGG + Intronic
1174166037 20:48584149-48584171 GGCCCAGACAAGCACTGGTTCGG + Intergenic
1175943673 20:62549214-62549236 GGCCCACAGGAGCTGAGGCAGGG - Intergenic
1179324832 21:40332048-40332070 GGACTCCAGAAGCTCTTGCTTGG - Intronic
1179680309 21:43016101-43016123 GGCCCACAGAATCACCGCCTTGG + Intronic
1180190384 21:46160077-46160099 TGGCCTGAGAAGCTCTGGCTGGG - Intergenic
1181759773 22:25050244-25050266 GGCACACTGAAGCTCTGAATGGG - Intronic
1181854822 22:25774277-25774299 GGACCTCAGAAGCTCTGGGTGGG + Intronic
1183074818 22:35420117-35420139 GGCCCATAGTAGCTCTGGGCAGG + Intronic
1183134701 22:35875395-35875417 GGGCCACTGAGCCTCTGGCTAGG + Intronic
1184117969 22:42432935-42432957 GACCCACAGAGGTTCTCGCTGGG - Intergenic
1185066691 22:48635793-48635815 GAACCACAGACGCTCTGGCTTGG + Intronic
1185297969 22:50063637-50063659 GGCCCACAGGAGCACCCGCTGGG - Intronic
1185420879 22:50733729-50733751 GGGCCACGGCAGCACTGGCTGGG - Intergenic
950199037 3:11029657-11029679 GGCCCACAGAAGGCCTGGCATGG + Intronic
950456883 3:13098005-13098027 GGCCCTGAGATGCTCAGGCTTGG - Intergenic
950880611 3:16319980-16320002 CTGCCACAGATGCTCTGGCTTGG - Intronic
953179142 3:40580464-40580486 CGCTCACACAATCTCTGGCTAGG + Intergenic
953575878 3:44112815-44112837 GGCCCACAGAATCCCAGGCTGGG - Intergenic
955208461 3:56918540-56918562 GGCCAACAGATGCCCTGGCAGGG + Intronic
956732537 3:72209859-72209881 CACCCCCAGAAACTCTGGCTTGG + Intergenic
965745053 3:171916184-171916206 GGCCCTCAGAAGCCCTAGATAGG + Intronic
967121040 3:186383255-186383277 GGGCCACAGAAGTACAGGCTGGG - Intergenic
968925828 4:3547491-3547513 AGCCAACAGAGGCTGTGGCTTGG + Intergenic
970132691 4:12888627-12888649 AGCCCAGAGAAGCTCAGCCTAGG - Intergenic
977518010 4:98046487-98046509 GGCACCCAGAATCTCTGGCCAGG - Intronic
980098670 4:128519692-128519714 GGTCCACAGTAGCCTTGGCTGGG + Intergenic
981283285 4:142985505-142985527 GGCCCCCAGTATCTCTGGCTGGG + Intergenic
982273025 4:153610777-153610799 GTCCCACAGAAGGGCTGGATTGG + Intronic
982584018 4:157214746-157214768 TGTCCACAGAATCTCTGGCCAGG - Intronic
984748310 4:183245590-183245612 GGCCCCCAGAAACTCTTACTGGG + Intronic
986721281 5:10563348-10563370 GGCCCACAGCCCCTCTGGCCCGG - Intergenic
987906838 5:24088480-24088502 GGTGGCCAGAAGCTCTGGCTGGG - Intronic
988378084 5:30464670-30464692 GGCTCCCAGAACCTCTCGCTGGG + Intergenic
988793391 5:34630024-34630046 GGCTCCCTGAAACTCTGGCTAGG + Intergenic
988892886 5:35638410-35638432 GGACCACAGAAGCTTTGGTTAGG - Intronic
990278380 5:54224172-54224194 AGCCCACATATCCTCTGGCTTGG - Intronic
991561199 5:67955540-67955562 AACCCACAGAATCTCTGGTTTGG + Intergenic
992752718 5:79875662-79875684 GCACCACTGAAGCCCTGGCTGGG - Intergenic
994784074 5:104133054-104133076 GGCCCATAGAATCTCTAGCCAGG - Intergenic
994932457 5:106206362-106206384 GGCCAGCAGAAGTTCTGGGTGGG - Intergenic
997517517 5:134501537-134501559 GGCACACAGAAGCTCTGCAAAGG + Intergenic
998793976 5:145797691-145797713 GGCCCCCAGAATCTCAAGCTAGG + Intronic
999354477 5:150911849-150911871 GGCACTTAGAATCTCTGGCTGGG + Intergenic
1001349581 5:170946567-170946589 GGCCCACAGGAGCAATGGTTCGG - Intronic
1001819521 5:174699058-174699080 GGCTCAGGGAAGCTCTGCCTTGG - Intergenic
1002616419 5:180459216-180459238 GGCCAGCAGAAGTTCTGGGTGGG + Intergenic
1002764378 6:226689-226711 GGGCCTCCGAAGCTCTGGCCTGG + Intergenic
1003015150 6:2462201-2462223 GGCTCACAGAGGGTCTCGCTGGG + Intergenic
1003283292 6:4712500-4712522 AGCCCACAGCAGCCATGGCTGGG + Intronic
1005568978 6:27126278-27126300 ACCCCACAGCAGCTCTGGCATGG + Exonic
1006184068 6:32170539-32170561 AGCCCACAGTAGCTCGCGCTTGG + Exonic
1007420094 6:41713949-41713971 GGCCCACTCTAGCTCAGGCTGGG - Intronic
1010564327 6:77391081-77391103 GGCACTTAGAATCTCTGGCTGGG - Intergenic
1013348840 6:109288204-109288226 GTCACTCAGAATCTCTGGCTTGG + Intergenic
1014887629 6:126801026-126801048 GGCCCACAGGAGCTCTGTCAGGG - Intergenic
1018109260 6:160519862-160519884 AACCTACAGAAGTTCTGGCTGGG + Intergenic
1018126309 6:160685859-160685881 AACCCACAGAAGTGCTGGCTTGG - Intergenic
1018150176 6:160930688-160930710 TACCCACAGAAGTGCTGGCTTGG + Intergenic
1018834098 6:167470532-167470554 CACCCACAGCAGCCCTGGCTGGG - Intergenic
1019078306 6:169409775-169409797 GTCCCACAGGACCTTTGGCTTGG + Intergenic
1019721074 7:2571618-2571640 ACCCCGCAGAAGCTGTGGCTGGG + Exonic
1020012806 7:4815776-4815798 GCCCCACAGTGGCCCTGGCTGGG + Intronic
1020411344 7:7895275-7895297 AGCCCAGAGATGCTCTGGCAGGG + Intronic
1020511249 7:9060290-9060312 GGCACCCAGAATCTCTGGCCAGG - Intergenic
1024030458 7:45455975-45455997 GGCCCACAGACTCACTGGCCAGG + Intergenic
1024120047 7:46227498-46227520 CGCCTAGAGAAGCACTGGCTGGG - Intergenic
1025213170 7:57032942-57032964 GGCTCACAGCAGCACTGGCAGGG + Intergenic
1025658783 7:63543882-63543904 GGCTCACAGCAGCACTGGCAGGG - Intergenic
1026719214 7:72816492-72816514 ACCCCAGAGAAGCTCTGGGTTGG + Intronic
1029606192 7:101600846-101600868 GGCCCAGAGCAGTCCTGGCTGGG - Intergenic
1031923280 7:127616403-127616425 GGACCCCAGAATCTCTGGCTCGG - Intergenic
1033466190 7:141592211-141592233 GGCCCAAAGCAGCTCTCACTGGG + Intronic
1034739893 7:153463994-153464016 GGCTCCCAGAAGCACTGGCAGGG - Intergenic
1035060509 7:156066033-156066055 TGCCAACAGAAGCTCTCTCTGGG - Intergenic
1035227251 7:157440522-157440544 GGCCCAGGCAGGCTCTGGCTGGG - Intergenic
1037484122 8:19331411-19331433 GGCCCACAGTTGCCCTGGGTAGG + Intronic
1039403660 8:37294426-37294448 GGCACAGAGAAGCTCAGCCTGGG + Intergenic
1039625753 8:39050619-39050641 GGCCCAAAAAAGCTCTGGCCAGG - Intronic
1041114545 8:54522616-54522638 CGCCCACAAAAACTCTGGCGTGG + Intergenic
1041773042 8:61493582-61493604 TCCCCAGAGAAGCTCTGGCCTGG - Intronic
1046023133 8:108690450-108690472 TGGCAACAGAAGCTCTGGCAAGG + Intronic
1048293099 8:133195534-133195556 AGCCCAAAGAGGCTCTGGGTGGG - Intronic
1048819621 8:138369001-138369023 GGACCAGAGAAGCTCTGACCTGG + Intronic
1048919613 8:139215981-139216003 GGCCCAGGGCAGCTCTTGCTGGG - Intergenic
1049381578 8:142319064-142319086 GGCGCAGGTAAGCTCTGGCTGGG + Intronic
1049673643 8:143880309-143880331 GGCTCCCAGAAGCCCTGACTGGG - Intergenic
1050036387 9:1440248-1440270 GGCCCACATAATCTCAGGGTGGG - Intergenic
1050428208 9:5534460-5534482 GTCCACCAGAAGCTCTTGCTGGG + Intronic
1051916308 9:22212125-22212147 TGCACACAGAAGCTCTGGTCTGG + Intergenic
1052997099 9:34557009-34557031 GGCAGGCAGAAGGTCTGGCTGGG + Intronic
1053121081 9:35547916-35547938 GGCCCACAGCAGCTGCTGCTTGG - Exonic
1053464789 9:38297926-38297948 GCCCCACACTACCTCTGGCTAGG - Intergenic
1058231682 9:102434282-102434304 AGCCAACAGAAGCTCTGCCATGG + Intergenic
1058804938 9:108581703-108581725 GGCCCACTTAAGATTTGGCTTGG - Intergenic
1060978407 9:127778823-127778845 GGCCCACAGGGGCTGGGGCTAGG - Intergenic
1061272240 9:129550121-129550143 GGACCCCAGAAGCTCGGGCGGGG + Intergenic
1061667071 9:132166786-132166808 GGCCCAGAGAAGCCCTGGAGAGG - Exonic
1062096847 9:134708012-134708034 GGCCCAGGGAAGGTCTGGCGAGG - Intronic
1203441681 Un_GL000219v1:15575-15597 CGCCCACTGAAGCCCTGGCGGGG - Intergenic
1188852663 X:35150906-35150928 GGTCCAGAGAAGCTGTGGTTAGG - Intergenic
1189006017 X:36995694-36995716 GGCCCCCAGAATCTCTAGCCAGG + Intergenic
1189042571 X:37558109-37558131 GGCCCCCAGAATCTCTAGCCAGG - Intronic
1189622457 X:42856664-42856686 GTCTCACAGTAGCACTGGCTGGG + Intergenic
1190077407 X:47327873-47327895 GGCCCAGAGAAACCCTGCCTGGG - Intergenic
1190719472 X:53135484-53135506 AGCCCACAGCAGATCTGGCAAGG - Intergenic
1191725219 X:64272065-64272087 GGCCCACAGAAGCTCTGGCTTGG + Intronic
1195744723 X:108105264-108105286 GGCCCCCAGAATCTCTAGCTGGG - Intronic
1197056813 X:122131723-122131745 GGCTCCCAGAATCTCTAGCTAGG - Intergenic
1197718094 X:129724641-129724663 ATCCTACAGAAGCTCTGACTGGG - Intergenic
1198152260 X:133922679-133922701 CGCCCCCAGAAGATCTAGCTTGG + Intronic
1199234728 X:145478005-145478027 GGCCCTCATGACCTCTGGCTTGG - Intergenic
1199822596 X:151464016-151464038 GACCCACAGTAGATCTGGGTGGG + Intergenic
1199855359 X:151755063-151755085 GGCCCACAGTGGCTCAGTCTGGG - Intergenic
1200093151 X:153645040-153645062 GGCCCACTGCAGCTGTGGGTGGG - Intronic
1200182080 X:154156693-154156715 GGCCAGCTGGAGCTCTGGCTGGG - Intronic
1200187734 X:154193807-154193829 GGCCAGCCGGAGCTCTGGCTGGG - Intergenic
1200193384 X:154230947-154230969 GGCCAGCCGGAGCTCTGGCTGGG - Intronic
1200199139 X:154268751-154268773 GGCCAGCCGGAGCTCTGGCTGGG - Intronic