ID: 1191727145

View in Genome Browser
Species Human (GRCh38)
Location X:64293363-64293385
Sequence CTGGCTCTACGTGGTTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191727145_1191727151 14 Left 1191727145 X:64293363-64293385 CCAAGCAAACCACGTAGAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1191727151 X:64293400-64293422 TTGAACCCTGAGTAAACAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 187
1191727145_1191727156 25 Left 1191727145 X:64293363-64293385 CCAAGCAAACCACGTAGAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1191727156 X:64293411-64293433 GTAAACAAAAGGGGTTACATTGG 0: 1
1: 0
2: 2
3: 37
4: 528
1191727145_1191727152 15 Left 1191727145 X:64293363-64293385 CCAAGCAAACCACGTAGAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1191727152 X:64293401-64293423 TGAACCCTGAGTAAACAAAAGGG 0: 1
1: 0
2: 0
3: 27
4: 296
1191727145_1191727153 16 Left 1191727145 X:64293363-64293385 CCAAGCAAACCACGTAGAGCCAG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1191727153 X:64293402-64293424 GAACCCTGAGTAAACAAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191727145 Original CRISPR CTGGCTCTACGTGGTTTGCT TGG (reversed) Intronic
909896472 1:81077183-81077205 TTGGCTTTACTTTGTTTGCTAGG + Intergenic
913225497 1:116694943-116694965 TTGGCTCTAGGCAGTTTGCTTGG + Intronic
920245754 1:204586068-204586090 CTGTCTCTTCCTGGTGTGCTGGG + Intergenic
922672563 1:227522206-227522228 CTGGCTCACTGTGGTGTGCTTGG - Intergenic
1069177257 10:65308091-65308113 GTGGCTCTTAGTGGTGTGCTGGG - Intergenic
1074374496 10:112928170-112928192 CTGGTACTACCTGGGTTGCTGGG - Intergenic
1074892671 10:117748619-117748641 GTGGCTCTGTGTGGTTTGCTGGG - Intergenic
1076340220 10:129740372-129740394 CTTGCTCTCCCTGGTTTCCTGGG - Intronic
1076873660 10:133205567-133205589 CTGGACCATCGTGGTTTGCTGGG - Intronic
1077051603 11:569103-569125 CTGGCTCTGCCTGGTTTGCCTGG + Intergenic
1084165034 11:67371647-67371669 CTGGCTCTCAGTGGGCTGCTGGG - Intronic
1085722695 11:78926897-78926919 CTGGCTTTGCGTGATTTTCTAGG + Intronic
1091645617 12:2270266-2270288 CTGGCTCAAGGTAGTTTGCAAGG - Intronic
1091877761 12:3950562-3950584 ATGGATCTACCTGGTTTCCTGGG - Intergenic
1092580691 12:9837925-9837947 CTGGCTGTAGGTGGTTTGTTTGG - Intronic
1101716626 12:107318391-107318413 CTGGCTGCCCGGGGTTTGCTGGG + Exonic
1104318507 12:127727019-127727041 CTCCCTCTACTTCGTTTGCTCGG - Intergenic
1112491999 13:99875031-99875053 ATGGCTGTACGTGCTTTGTTTGG + Intronic
1114133538 14:19820655-19820677 CTGGCTATAGCTGCTTTGCTGGG + Intronic
1118379381 14:65205111-65205133 CTAACTCTACGTGCTTTGGTCGG - Intergenic
1123576610 15:21676224-21676246 CTGGCTATAGCTGCTTTGCTGGG + Intergenic
1123613232 15:22118692-22118714 CTGGCTATAGCTGCTTTGCTGGG + Intergenic
1130291235 15:82603309-82603331 CTGGCTGTACTTGGTGAGCTCGG - Intronic
1130291777 15:82608312-82608334 CTGGCTGTACTTGGTGAGCTCGG + Intronic
1202985478 15_KI270727v1_random:410469-410491 CTGGCTATAGCTGCTTTGCTGGG + Intergenic
1134040321 16:11063527-11063549 CTGACTCCATGTGGTCTGCTAGG + Intronic
1141697220 16:85625804-85625826 GTGGCTCTACGTGGTTGACCGGG + Intronic
1142571705 17:878806-878828 CTGGCTCTGCGTGTTTTTTTAGG - Intronic
1147445227 17:40471208-40471230 CTGGCTCTGCGTAGTTCACTGGG + Intergenic
1153385748 18:4493386-4493408 CTGGCACTACGGGGTGTTCTAGG + Intergenic
1159443234 18:68508373-68508395 CTCCCTCTACGTGGCTTCCTGGG + Intergenic
1160874402 19:1290490-1290512 CTGGCCCTACGTGGGTCCCTCGG + Intronic
1162766708 19:12924332-12924354 CTGGGTCTAGGTGGTGAGCTTGG + Intronic
1166980975 19:46631848-46631870 CTGGCTGGAGGTGGCTTGCTGGG - Intergenic
1168081305 19:54012373-54012395 GTGGCTGTATGTGGGTTGCTTGG + Exonic
925077157 2:1026578-1026600 ATGGCTCTTCGTGTTTTCCTAGG + Intronic
925408671 2:3626211-3626233 CTAGATGGACGTGGTTTGCTGGG + Intronic
931184002 2:59931872-59931894 CTGGCTCTGCCTGGCTTGCCAGG - Intergenic
937632634 2:124120618-124120640 CTGTCCTTACGTGGTTTGGTTGG - Intronic
938085309 2:128396066-128396088 CTGGCTCTAGCTAGTTTCCTGGG + Intergenic
941230441 2:162905253-162905275 CTTGTTCTATGTGGTTTCCTTGG + Intergenic
941365935 2:164611536-164611558 TTGGCTCTACTTGGTTTAATAGG - Intronic
944140072 2:196446504-196446526 CTGGACCTACATGGTTTTCTTGG + Intronic
948560220 2:238847269-238847291 CTGGCCCTACCCGGGTTGCTGGG - Intergenic
948753120 2:240143894-240143916 CCGGCTCTGCCTGGTTGGCTTGG - Intronic
1173572108 20:44083999-44084021 CCTGCTCCACGTGGTTGGCTAGG + Intergenic
1174421753 20:50403799-50403821 TTGTCTGTTCGTGGTTTGCTAGG - Intergenic
1176084110 20:63288136-63288158 GGGGCTCTGCGTGGCTTGCTGGG + Exonic
1179180142 21:39037841-39037863 CTGGCTCTCCTTGCTTTGCTGGG - Intergenic
949263638 3:2132156-2132178 CTTTCTCCACGTGGTTAGCTTGG - Intronic
949996709 3:9623069-9623091 CTGGCTTCAGGTGGTTTGCTGGG - Intergenic
954868676 3:53750661-53750683 CTGGCTCTGCGTGGCTGGCCTGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
971052699 4:22879060-22879082 CTGCCTCTAAGAGGTTTCCTGGG - Intergenic
972363419 4:38350228-38350250 TTGGGTCTAGATGGTTTGCTTGG - Intergenic
976066526 4:81193970-81193992 CTGGCACTGTGTGGTTTGGTGGG - Intronic
979500957 4:121439545-121439567 TGGGCTCCATGTGGTTTGCTTGG + Intergenic
984119867 4:175728976-175728998 CTGGCTCTAAGTGGTTCCCCAGG + Intronic
985952871 5:3236799-3236821 CTGGCCCTACGTGAGGTGCTGGG + Intergenic
990988537 5:61662531-61662553 CTGCCTCTACATGCTCTGCTTGG + Intronic
993008966 5:82458535-82458557 CTCCCTCTACCTGGGTTGCTTGG - Intergenic
997595922 5:135107472-135107494 CTGGCGCAACCTTGTTTGCTGGG + Intronic
997859625 5:137404749-137404771 CTGGCTTGATGTGGTTTGTTTGG - Intronic
1006190397 6:32204071-32204093 CTGGCTCTCCATGGTCTGCTTGG + Intronic
1007894910 6:45344687-45344709 CTAGCTCTTCATGGTTGGCTAGG + Intronic
1013827507 6:114231590-114231612 AACGCTCTAGGTGGTTTGCTGGG + Intronic
1023854925 7:44176932-44176954 CTGGCTTGACGTGGTGGGCTGGG + Intronic
1025249066 7:57339655-57339677 TTGTCTCTACGTGGTTTGCAAGG + Intergenic
1028615746 7:92764693-92764715 CTGGCACTATGGGGTTTGCAAGG + Intronic
1030675971 7:112385417-112385439 CTGGCACCACGTGGTGTGCCTGG + Intergenic
1036475889 8:9092927-9092949 CTGGCTTCTGGTGGTTTGCTGGG + Intronic
1044661989 8:94600609-94600631 TTGGCTCTGCTTGGTTTCCTTGG - Intergenic
1050751698 9:8946382-8946404 CTGGCTCTTCTTTGTGTGCTTGG + Intronic
1056849463 9:90070165-90070187 CTGGAACTTTGTGGTTTGCTTGG + Intergenic
1191727145 X:64293363-64293385 CTGGCTCTACGTGGTTTGCTTGG - Intronic
1192787130 X:74346644-74346666 CTGACTGTAGGTGGTTTGTTTGG - Intergenic
1193086192 X:77449169-77449191 CTGCCCCTAAGTTGTTTGCTAGG - Intronic