ID: 1191731212

View in Genome Browser
Species Human (GRCh38)
Location X:64337624-64337646
Sequence CAGGGCAAAAAGAAAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 1, 2: 4, 3: 63, 4: 663}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191731206_1191731212 14 Left 1191731206 X:64337587-64337609 CCACATAGGAAAAGAATATCAAA 0: 1
1: 0
2: 4
3: 59
4: 565
Right 1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG 0: 1
1: 1
2: 4
3: 63
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191731212 Original CRISPR CAGGGCAAAAAGAAAGATGA GGG Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
901338856 1:8476562-8476584 CAGTGCTAAATGAAAGCTGATGG + Intronic
902745018 1:18468042-18468064 CAGAGCAAAAAGAGAGAGGTAGG + Intergenic
903857771 1:26346716-26346738 CAGAGGAATAAGAAAGATGAGGG + Intronic
905022598 1:34828152-34828174 CAGAGCAAAAATAGAGCTGAGGG - Intronic
906387232 1:45380644-45380666 CAGAGCAAAGAGAAAGAATAAGG + Intronic
907634731 1:56122630-56122652 CTGAGCAAAAAGAAAGCTGGAGG - Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907985197 1:59523812-59523834 AAGGGCAAAGAGACAGCTGATGG - Intronic
908256909 1:62310415-62310437 CAGGGGCCAAAGAAAGGTGAGGG + Intronic
908280196 1:62525422-62525444 CAGGTCAAAAACAAGGATGTTGG - Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908961682 1:69705503-69705525 CAGGGCATACACACAGATGAGGG + Intronic
909263662 1:73527760-73527782 CAGGGACTAAAGAAAGATGATGG + Intergenic
909836199 1:80258655-80258677 CAGGGAAAATTGAAAGATCATGG + Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
910056089 1:83034571-83034593 CAGTGCAAGTAGAAAGATAATGG + Intergenic
910649405 1:89549324-89549346 CAGGGTTAATAGAAACATGAAGG - Intronic
911090608 1:94014248-94014270 GAGGGCAGAAGGAAAGAGGAAGG + Intronic
911179004 1:94844493-94844515 GAGAGCTAAAAGAAAGATCATGG + Intronic
911220543 1:95240844-95240866 GAGGGAAAAAAAAAAGTTGAAGG + Intronic
911669741 1:100594021-100594043 CGGGGGGCAAAGAAAGATGATGG - Intergenic
911833943 1:102592160-102592182 CTGAGAAAAAATAAAGATGATGG + Intergenic
911946165 1:104112245-104112267 AAGTGCTCAAAGAAAGATGAGGG - Intergenic
912885321 1:113465444-113465466 CTGGGCAAAAAGAATGAAGCTGG - Intronic
913120197 1:115732977-115732999 AAGGGGAAAAATAAAGATGAAGG + Intronic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914193827 1:145433538-145433560 GAGAGCAGAAAGAAAGTTGATGG + Intergenic
914475156 1:148016412-148016434 GAGAGCAGAAAGAAAGTTGATGG + Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914792157 1:150887729-150887751 TAGTGCAAAGAGAGAGATGATGG - Intergenic
915785044 1:158601352-158601374 CAGGGCAAAAAGAACAAAGCTGG + Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
917672114 1:177282711-177282733 CAGGGAGAAAAAAAAGGTGATGG - Intergenic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
919133279 1:193477288-193477310 GAGGGGAAGTAGAAAGATGATGG + Intergenic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920053980 1:203179714-203179736 CAGGACAAAGAGAAAGAAGGAGG - Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920873090 1:209810198-209810220 CAGGGCCAAGAGAAAAGTGAGGG - Intergenic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
921508865 1:216007584-216007606 CAGAGCAAAAAGAAAGACTTTGG + Intronic
921589543 1:216987528-216987550 CAGGGGAAGAAGACAAATGAAGG + Intronic
921732352 1:218592528-218592550 CAGGACAAAAAGAAAAAAAATGG - Intergenic
922125776 1:222721772-222721794 AAGGGCAAAAAGCAAGCTGAAGG - Intronic
922998634 1:229987241-229987263 CAGGGCAGAAAGAAAGGAGCTGG + Intergenic
924844558 1:247752502-247752524 CTGGGCAAAAATAAAGCTGGAGG - Intergenic
1064168351 10:13005939-13005961 CAAGGCAAAAGGAAAGTTGCTGG - Intronic
1065605720 10:27415545-27415567 CATGGCAATGAGAAAAATGAGGG - Intergenic
1066092055 10:32032492-32032514 CAGGGTGAAAAAAAAGATGGCGG + Intronic
1066130548 10:32389187-32389209 ATGGGCAAAAACAAAGATGTGGG + Intergenic
1066151465 10:32624210-32624232 CAGGGCAACAAAAAAGATAATGG - Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067517128 10:46960336-46960358 CAGAGAAAAAAGGTAGATGAGGG - Intronic
1067550666 10:47233421-47233443 CAGGGCAAAATGATAGAACATGG - Intergenic
1067645121 10:48091493-48091515 CAGAGAAAAAAGGTAGATGAGGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067832778 10:49620010-49620032 CAGGGCAGAAGGAGAGATGAGGG + Intronic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1068268463 10:54686511-54686533 AAGTGCAAAAAGAAATATGAGGG - Intronic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1068926660 10:62546894-62546916 CAGGTCAGAAAGAAAGAGAAGGG + Intronic
1069265252 10:66449163-66449185 CCGAGCAAAATGAGAGATGAGGG + Intronic
1070068118 10:73058154-73058176 AAGGGAAAAAAGAAAGGGGATGG + Intronic
1070376366 10:75835167-75835189 CAGGGCTAAAATTAAGGTGATGG + Intronic
1071145442 10:82565010-82565032 CAGGGCAAAAAGAACACTGTTGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073039912 10:100596592-100596614 AAGAGAGAAAAGAAAGATGATGG - Intergenic
1073507965 10:104018367-104018389 CAGGGCAAGAAGAAATTTTAAGG - Intronic
1074048644 10:109862439-109862461 CGAGGGAAAAAGAAAAATGAAGG - Intergenic
1074287636 10:112113300-112113322 CAGGGCAAAAACACAGATAATGG + Intergenic
1074296436 10:112193493-112193515 AAGGGCAAACAGGCAGATGATGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074910844 10:117906876-117906898 CAGAGCAAAAAGAAACTTCATGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075651046 10:124128512-124128534 CAAGGAAAAAAACAAGATGAGGG - Intergenic
1075892104 10:125960940-125960962 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1075922882 10:126227722-126227744 GAGGGGAAAGAGAAAGGTGATGG - Intronic
1076023855 10:127096144-127096166 CAGAACAAAAAGAAAGACGATGG - Intronic
1076583030 10:131526675-131526697 GAGGGCAGAAAAAAACATGAGGG + Intergenic
1078149503 11:8746700-8746722 TAGGGCAGAAAGAAAGACCAGGG + Intronic
1079469963 11:20768827-20768849 CAGGACAAAAACCAAGATGGGGG - Intronic
1079715347 11:23736588-23736610 CTAAGCAAAAAGAAAGATGGAGG + Intergenic
1080116138 11:28623321-28623343 CAGGACAGAAAGAAAGATCCCGG + Intergenic
1081004883 11:37723962-37723984 AAGGTCAAGAAGAAAGATGTAGG - Intergenic
1081170768 11:39867735-39867757 TAAGGCAGAAAAAAAGATGATGG + Intergenic
1081576768 11:44323614-44323636 CAGGTCAGAAGGAAAGGTGAGGG + Intergenic
1082729667 11:56779904-56779926 CAGGGCAGAAAGGATGATCAAGG - Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1083732330 11:64659365-64659387 CAGGGCAAAAAGAAAACAGCAGG - Intronic
1085007161 11:73102693-73102715 AAGGGCAAAAAGAGAGAGAAGGG - Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085749607 11:79149860-79149882 CAGTGCACAAGGAAAGATCAAGG + Intronic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086890170 11:92248125-92248147 GAGGGAAAAAGGAAAGATGAGGG - Intergenic
1087727569 11:101739857-101739879 CACGTGAAAAAGAAAAATGAAGG + Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1090534839 11:127629396-127629418 CAGAGCCAAAAGAAAGAACACGG + Intergenic
1090969539 11:131628546-131628568 CAGGCCCAAAATAAAGTTGAAGG - Intronic
1090974649 11:131671063-131671085 AAGGGTCAGAAGAAAGATGATGG - Intronic
1091523126 12:1268177-1268199 AAAGGCAATAAGAAAGACGAAGG - Intronic
1091637106 12:2205459-2205481 CAGGGCAAGATGAAAGGTTAAGG - Intronic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1092281824 12:7103241-7103263 AAGGGCAAAAAGAAAGCTGGAGG - Intronic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092891526 12:12973652-12973674 CAAGACTAAGAGAAAGATGATGG - Intergenic
1093119637 12:15253212-15253234 CAGTGCAACAGGAAAGATAATGG + Intronic
1093190213 12:16065620-16065642 CAGGGCAGAAAGAACCACGATGG + Intergenic
1093382667 12:18512777-18512799 CAAGACAAAAAGAAAATTGAAGG - Intronic
1093606980 12:21103988-21104010 CAGGGAAAAAAGAAAACTGCTGG - Intronic
1094162739 12:27408741-27408763 CAGGGCAATAAGGAAGGAGAAGG + Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094413739 12:30196024-30196046 CAGGAAAAAAAGAAAGAATAAGG - Intergenic
1094820046 12:34217532-34217554 AAAGAAAAAAAGAAAGATGAAGG + Intergenic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1095301776 12:40592738-40592760 CTGGGCAAAAATAAAGGTGTAGG - Intergenic
1095416525 12:41983246-41983268 CAGGGTTAAATGAAAAATGAGGG - Intergenic
1095734943 12:45546667-45546689 AAGGGCAAAAAGCAAGATCTAGG - Intergenic
1096260425 12:50086618-50086640 CAGTGCAAAGAAAAAGAAGATGG + Exonic
1096572149 12:52529693-52529715 CTGGGCAAAAATCAAGATGCTGG - Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1098037660 12:66321761-66321783 CAGGGCAATAGGAAAGAGAATGG - Intronic
1098486275 12:71025567-71025589 CAGAGCAAAAATACAGATGGAGG + Intergenic
1098675029 12:73279273-73279295 CTGGGAAAAAAGAAAGATGTTGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099408588 12:82294886-82294908 CAGGACTAAAAGGCAGATGAAGG - Intronic
1099601266 12:84741244-84741266 CTGAGAAAGAAGAAAGATGAAGG + Intergenic
1099626355 12:85079760-85079782 AAGGGCAAAAAGAAAAAAGCAGG - Intronic
1100141068 12:91619515-91619537 CAGGGTAAAATGAGAGCTGAAGG + Intergenic
1100186775 12:92147067-92147089 AAAGAAAAAAAGAAAGATGAAGG + Intergenic
1100233591 12:92634879-92634901 AAGTCCAAAAATAAAGATGACGG + Intergenic
1101427615 12:104600836-104600858 GAGGGAAAAAAGAGAGATGGGGG - Intronic
1101845044 12:108356870-108356892 CAGGGCAAAAATAAAAACGGTGG + Intergenic
1102407299 12:112684960-112684982 CAGAGCAAAAAGAAAGAAAAGGG - Intronic
1102901025 12:116637060-116637082 CAGAGCAAAAGTAAACATGAAGG + Intergenic
1102972362 12:117179446-117179468 AAGGGAAAAAAAAAAGATGGAGG - Intronic
1103157735 12:118701225-118701247 AAGGGCAAAAAGCAAGTTGATGG - Intergenic
1106437751 13:29738902-29738924 CAGGGAAAAAAGAGAGCTCAGGG - Intergenic
1107149101 13:37091287-37091309 CATGGGAAAAAGGAAGAAGAGGG + Intergenic
1107155049 13:37155981-37156003 CAAAGCAAAAAAAAAGATGAAGG - Intergenic
1107832976 13:44390736-44390758 GAGGGAAAAAAGAGAGATGCCGG - Intronic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109325540 13:60862989-60863011 CACGGCAATAAGGGAGATGAAGG + Intergenic
1109548405 13:63860062-63860084 CAGGGCAAAATGAAGTATGGTGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109753046 13:66721806-66721828 AAGGGCACAAAGAAAGATACAGG - Intronic
1109900700 13:68765727-68765749 CAGGGGAAATGGGAAGATGATGG + Intergenic
1110328745 13:74247469-74247491 TAGGTGAAGAAGAAAGATGAAGG + Intergenic
1110520523 13:76470665-76470687 CAGGGCAAAGAGAAACATAATGG - Intergenic
1110570182 13:76994383-76994405 GAGGGCAAAGAAAGAGATGAAGG - Intronic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111466341 13:88616375-88616397 CAGTGTATTAAGAAAGATGATGG + Intergenic
1111567933 13:90041226-90041248 CAGAGAAAAATGAAACATGAAGG + Intergenic
1111996515 13:95170959-95170981 CAGGGGAGAAAGAAAGATCGAGG + Intronic
1112552754 13:100436930-100436952 GAGAGCAAAAAGAAACAAGAGGG + Intronic
1112906821 13:104432921-104432943 CAGGGCAATAAGAAAGAAAATGG - Intergenic
1113106113 13:106773059-106773081 CAGGGTAAAAATAAAGCTAAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113511235 13:110856301-110856323 CAGTGCTCAAGGAAAGATGATGG + Intergenic
1113883356 13:113642030-113642052 AAGGGGAAAGAGAAAAATGAAGG - Intergenic
1114798425 14:25743076-25743098 TAGAGGAAAAGGAAAGATGAAGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115630036 14:35235604-35235626 CAGGCCAAGAAGAAAGCTGCTGG - Intronic
1115831222 14:37344280-37344302 CAGGGGAATAAAAAAGATGAAGG - Intronic
1115872516 14:37821052-37821074 AAAGGAAAAAAGAAAGAAGAAGG - Intronic
1116656152 14:47656275-47656297 CAGTGCAATAGGAAAGATGTAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116923864 14:50612653-50612675 GAGGGCTAAAAGAAAGAAAAAGG - Intronic
1117134557 14:52721656-52721678 CAGGGGAAAAAAAAAGAAAAGGG + Intronic
1117815030 14:59588739-59588761 CTGGTCAAATAGAAACATGAAGG + Intergenic
1118184474 14:63524335-63524357 AATGGCAAACAGAGAGATGAGGG + Intronic
1118517937 14:66547088-66547110 GAAGGCAAAAAGAAGCATGAGGG - Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118600314 14:67467433-67467455 CAGGGCAAAAAGAAGGCTGTGGG + Intronic
1118664334 14:68050355-68050377 CAGGAGAAAATGAAAGATGATGG - Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119727638 14:76931518-76931540 GAGGGAAAAATCAAAGATGAGGG - Intergenic
1120051207 14:79868461-79868483 AAGGGCCACAAGAAAGCTGAAGG - Intergenic
1121646428 14:95520450-95520472 CAAGGAAAAAACAAAGAAGAAGG - Intergenic
1121706590 14:96000529-96000551 CAGGTGAAAAATAAAAATGAAGG - Intergenic
1122322269 14:100862189-100862211 GAGGACAAAAAGGAAGAAGAGGG - Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1123388918 15:19849114-19849136 AAAGGAAGAAAGAAAGATGAAGG + Intergenic
1124631131 15:31338199-31338221 CAGGGCAACTAGGAAGATCAGGG - Intronic
1125375218 15:39021466-39021488 CAGGGCCACAGGAAAGAGGAAGG + Intergenic
1125411653 15:39412487-39412509 AAGGACAAAAAGAAATAAGATGG - Intergenic
1125835811 15:42749726-42749748 AAGGGAAAAAAGAAAAATGAGGG - Intronic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1127394374 15:58532134-58532156 CAGGGCAAAATTCAAGATGGTGG + Intronic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1127898903 15:63326774-63326796 GAATTCAAAAAGAAAGATGAAGG - Intronic
1128095837 15:64954743-64954765 AAGAACAAAAAGAAAGAAGAAGG - Intronic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1128789702 15:70423913-70423935 GAGGGGCAAAAGGAAGATGAGGG - Intergenic
1128847584 15:70915024-70915046 CACAGCAAGAAAAAAGATGATGG - Intronic
1129063748 15:72883504-72883526 CAGGGAAAGAATAAAGATTAGGG - Intergenic
1131030957 15:89185606-89185628 CAGGGGAAAAAAAAAAATGCAGG + Intronic
1131081751 15:89542461-89542483 CAGAGAAAAACGAAAGAAGAAGG - Intergenic
1132222727 15:100117009-100117031 CAGGGCTAGAAGGAAGAAGAAGG + Exonic
1133773543 16:8881576-8881598 CAAGGCAAAAAGAAAAAAGTGGG + Intergenic
1134523538 16:14928877-14928899 AAGGGGGATAAGAAAGATGAGGG - Intronic
1134549354 16:15132043-15132065 AAGGGGGATAAGAAAGATGAGGG + Intronic
1134711132 16:16327361-16327383 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134718982 16:16370662-16370684 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134948442 16:18341222-18341244 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1134955699 16:18381332-18381354 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1135603530 16:23803076-23803098 CATTGTAAAAAGAAAGATTATGG - Intergenic
1135761300 16:25140368-25140390 CAGGGCAAAAAAAAAGTTGGTGG - Intronic
1136331789 16:29584252-29584274 CAGGGAAAAAAAAAAAAAGATGG - Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136934395 16:34445417-34445439 AACGGCACAAAGAAAGATGTGGG - Intergenic
1136970177 16:34966397-34966419 AACGGCACAAAGAAAGATGTGGG + Intergenic
1137010836 16:35317974-35317996 CAGGGTAAAAAGGAAGGTAAAGG + Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1137766663 16:50982642-50982664 CAGGGCGAGAAGAAAGGGGAAGG + Intergenic
1138062697 16:53908558-53908580 CAGGGCAATATCAAAGAGGATGG - Intronic
1138460020 16:57142606-57142628 CAAGGCAGAGGGAAAGATGAAGG - Intronic
1139822360 16:69730571-69730593 CAGTGCTATAAGAAAAATGAAGG + Intergenic
1140471385 16:75217198-75217220 CAGGGGAAAAAGAAAAAAAAAGG + Intergenic
1140925755 16:79581736-79581758 CAGTCCAAAAAGAGAGGTGAAGG - Intergenic
1140984663 16:80146695-80146717 CAAGTCACACAGAAAGATGATGG - Intergenic
1141050710 16:80760895-80760917 AAGGGGAAAAAGAAACATTAAGG + Intronic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141598612 16:85112253-85112275 CGGGGCACCAACAAAGATGAGGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143545512 17:7592935-7592957 TGGGCCAAAAGGAAAGATGATGG - Intronic
1143937523 17:10502405-10502427 ATGTGCAAAAAGAAAGAAGAGGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1145278704 17:21453307-21453329 TAGGGCAAAAAGAGAAAGGAAGG - Intergenic
1145820536 17:27830714-27830736 CAAGGCAAAAAGAGAAATGGTGG - Intronic
1145821405 17:27839108-27839130 CAAGGCAAAAAGAGAAATGGTGG + Intronic
1145833600 17:27937200-27937222 AAGGGCAAGAAGAAAAAGGAGGG - Intergenic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146505079 17:33397733-33397755 CAGTGCAACAAGAAAGCTCAGGG + Intronic
1146542524 17:33709955-33709977 CAATGCAAAAAGAAAGAAGGGGG - Intronic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1149024999 17:52017279-52017301 GAAGGCAGGAAGAAAGATGAAGG + Intronic
1149121845 17:53178210-53178232 CATGGCAAAAAGCAAAATGTAGG - Intergenic
1149488556 17:57064946-57064968 CAGGGCTAAAATCAAGATGGTGG + Intergenic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1150740244 17:67773572-67773594 CAGGGAAGAAGGACAGATGATGG + Intergenic
1151084866 17:71368392-71368414 CAGTGCAAAATGAAAAATGCAGG - Intergenic
1151411672 17:73934592-73934614 CAGGGCAGAGAGAAAGATAGAGG - Intergenic
1152978454 18:248385-248407 AAGGGCAAACACCAAGATGATGG + Intronic
1153193613 18:2569785-2569807 CAGTGCAAAAAGAGACTTGACGG - Intronic
1153295409 18:3541261-3541283 GATGGCAGAAAGAAAGAAGAAGG + Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153538823 18:6133517-6133539 CCAGGAAAAAGGAAAGATGAGGG - Intronic
1153656417 18:7286742-7286764 CAGAACAAATAAAAAGATGAAGG - Intergenic
1153957437 18:10109957-10109979 CAGGCTAGAAAGAAAGATGTCGG - Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154997168 18:21651781-21651803 CATGGCAATAAGAGAGAAGAAGG + Intronic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155531600 18:26772467-26772489 AAGGTGAAAATGAAAGATGAAGG - Intergenic
1155849846 18:30760049-30760071 CAGGGCACAAAGGCAGATAATGG - Intergenic
1156930080 18:42630984-42631006 CAGGGCAAGTAAAAAGTTGAAGG + Intergenic
1156953317 18:42931555-42931577 CAAGTCAAATAGAAAGAGGAAGG - Intronic
1156977539 18:43241640-43241662 CAGAGGAAAAAAAAAGTTGAAGG + Intergenic
1157725450 18:49960216-49960238 CAGGACATAAAGTCAGATGAAGG - Intronic
1158004688 18:52659080-52659102 CTGGGCAAAAGGTAAAATGATGG - Intronic
1158606825 18:58902929-58902951 CAGAGGAAAAAGAAAAACGAGGG - Intronic
1159058672 18:63491941-63491963 CAGGGCAAAAGTAAAAATGCTGG + Intronic
1159235605 18:65669067-65669089 TGGGGTAAATAGAAAGATGATGG - Intergenic
1159424552 18:68268431-68268453 CAGGGGAAAAAAGAAAATGAAGG + Intergenic
1159727211 18:71976038-71976060 GAGGGAAAATAAAAAGATGAAGG - Intergenic
1159840177 18:73390152-73390174 CAGGTCAAAGCGAGAGATGAGGG + Intergenic
1160379538 18:78441808-78441830 CACAGCAATAAGAAAGATCATGG + Intergenic
1161871609 19:6874852-6874874 CAGAGCAAAAAGTCAGAAGAGGG - Intergenic
1161886305 19:6998833-6998855 AATGGAAAACAGAAAGATGAAGG - Intergenic
1162860170 19:13500440-13500462 CAGAGAAATAAGAAAGATTAAGG - Intronic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1164741894 19:30582037-30582059 GAGGGAAAAAAGAGAGGTGAGGG + Intronic
1165144526 19:33722784-33722806 CAGGGAGAAAAGAGAGATGTGGG - Intronic
1166672435 19:44718976-44718998 CAGGGCAAAAAGGGAGAAGAAGG + Intergenic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
925910451 2:8570314-8570336 CATGGAGAAAAGAAAGATCACGG + Intergenic
926555967 2:14358392-14358414 TGTGGCAAAAAGAAAAATGAAGG + Intergenic
926607317 2:14910387-14910409 CAGGGCAAGATGAAAGCTTAGGG - Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
927248351 2:20976363-20976385 AAGATCAAATAGAAAGATGAAGG - Intergenic
928876130 2:36042056-36042078 CAGTGCAAGAAGAAATTTGAGGG - Intergenic
929123654 2:38503592-38503614 AAGGGCAAAAGGAAAGAGCAAGG - Intergenic
929606003 2:43234636-43234658 AAGGGAAAAAAGAAAGAAAAAGG - Intronic
930148630 2:48034055-48034077 TAAGGCAAAAAGAAAACTGAGGG + Intergenic
930175277 2:48295059-48295081 AAGGGAAAGAAGAAAAATGAAGG - Intergenic
930324781 2:49901641-49901663 CAAGGCAAAAAGAATGACTATGG - Intergenic
931293332 2:60897230-60897252 AAGTGCTCAAAGAAAGATGACGG - Intronic
932569280 2:72929521-72929543 CAGGGAAGAGAGAAAGCTGAGGG + Intronic
932778607 2:74545240-74545262 GAGGGTAAAAACAAAGATGGAGG - Intronic
933714121 2:85347901-85347923 CAGTGCAAAATGAAAAATGAAGG - Intronic
933814436 2:86054314-86054336 GATGGCAAAAAGAAAAGTGATGG + Intronic
935124146 2:100208092-100208114 CATGGCAAAAAAGAAGATCATGG + Intergenic
935533421 2:104263050-104263072 CCAGGCAAAAATAAAGTTGATGG + Intergenic
936437852 2:112523381-112523403 CAGGGTAGAAATAAAGAAGAAGG - Intronic
936865799 2:117075032-117075054 CAGGGATAAAAGAAATCTGAGGG - Intergenic
936940556 2:117879701-117879723 CAGCACAGAAAGAAAGATGAAGG - Intergenic
937071319 2:119065896-119065918 TAGGGCAATATGAAGGATGAAGG - Intergenic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
937946491 2:127343175-127343197 CAGGCCATAAAGAATGCTGATGG - Exonic
938620321 2:133045456-133045478 CAGATCAAAGAGAAACATGAAGG + Intronic
938799271 2:134745826-134745848 CAGCGGAAAAAGTGAGATGAAGG + Intergenic
939054488 2:137347237-137347259 GAAGGAAAAAAGAGAGATGAAGG + Intronic
939163564 2:138616228-138616250 TAGGGCACAAAGAAAAATTAGGG + Intergenic
939362036 2:141184833-141184855 TAGGGAAGAAATAAAGATGAAGG - Intronic
939805789 2:146774885-146774907 CAGCACGGAAAGAAAGATGAAGG - Intergenic
939817265 2:146911342-146911364 TAGGACAAAAGGAAGGATGAAGG + Intergenic
940193735 2:151069914-151069936 AAGGGCAAAAAGAAAAGAGAAGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
942354216 2:175090422-175090444 ATGGGCAAAAAGAAAGTTGTTGG - Intronic
942881382 2:180865276-180865298 CAGAGCAAAAAGAAAGAATCTGG + Intergenic
942948396 2:181695234-181695256 AAGGGCAAAAAGTAAAATGTTGG + Intergenic
943355873 2:186854642-186854664 TAGAGCAAAAAGAAAAAAGATGG + Intergenic
943676032 2:190717270-190717292 CAGAGCAACAAGAAAAATGCCGG - Intergenic
943789880 2:191920338-191920360 CAGGACTAAAAGAACGAAGATGG + Intergenic
944632518 2:201642072-201642094 TAGGGCAGAAAGAAAGGTGGGGG + Intronic
945087283 2:206145180-206145202 CAGGGCAAAAAAAAAGGTGGGGG - Intronic
945752627 2:213807232-213807254 CAGTGCAAAGAAAAACATGAAGG - Intronic
945929300 2:215839413-215839435 CAGGGTAAAAAGACAGGTGGAGG + Intergenic
945960284 2:216126840-216126862 CAGGCCAAAATAAAAGAGGAGGG - Intronic
946106682 2:217376492-217376514 CAGAGCACAGAAAAAGATGAAGG + Intronic
946222916 2:218244305-218244327 TAGTGGCAAAAGAAAGATGATGG - Intronic
946864179 2:224027890-224027912 CAGGACAAGAAGGAAGTTGAAGG - Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947249616 2:228087090-228087112 CAGCCAAAAAAGAAAGATGGAGG + Intronic
947269044 2:228313121-228313143 CAGGGTGAAAAGTAAGATCAAGG - Intergenic
947282407 2:228469976-228469998 CAGGGCAGAAAGCAAGAGGTGGG - Intergenic
947783525 2:232792952-232792974 TAGGGCAAAAAGTAAGATAAGGG + Intronic
948194633 2:236086039-236086061 TAGGGCAAAAAGGAAGATCAGGG - Intronic
948228106 2:236328654-236328676 CAAGGCTAAAAGAAGGAAGAGGG - Intronic
1168874411 20:1160917-1160939 CAAGGCCAACAGAAAGAAGATGG + Intronic
1169532274 20:6498428-6498450 AAGGGCAAAAAGGAAGATGCTGG + Intergenic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1170102597 20:12718939-12718961 AAGGGTAAAATGAAAGATTAAGG + Intergenic
1170280323 20:14639220-14639242 CAGGAAAAAAAGAAAGGAGAGGG - Intronic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1170533470 20:17317041-17317063 CAGGGCAAAAAGAGAGAATGTGG - Intronic
1170747427 20:19113024-19113046 CAGGGCTAAAATCAAGATGTTGG + Intergenic
1170899321 20:20445348-20445370 CATGGCAGAAAGGCAGATGATGG + Intronic
1170973345 20:21137473-21137495 CAGGGCAAAAAAAAAAAAAAAGG - Intronic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1171998472 20:31752239-31752261 CAAGGCAAGAAGAAGGATAAAGG + Intronic
1172073285 20:32274721-32274743 CAGGGGAAAAAAAAATAGGAGGG + Intergenic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1172514761 20:35525547-35525569 CATCTCAAAAAAAAAGATGAGGG + Intronic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173304586 20:41836131-41836153 CAGGACACAGAGAAAGATGAAGG - Intergenic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174764577 20:53240597-53240619 CAGGTCAGAAAGAAAGATCTGGG + Intronic
1175009775 20:55723553-55723575 CAGGGCAAAAAGAAAAATTGTGG + Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175456604 20:59120097-59120119 GAGAGCAAAAAGAGGGATGATGG + Intergenic
1175520364 20:59598884-59598906 CAGGACCCAAGGAAAGATGAAGG - Intronic
1177039139 21:16084579-16084601 GAGGGCAAAAAAAAAGAGAAAGG - Intergenic
1177303063 21:19275348-19275370 AAGAGCATAAAGAAAGAAGAAGG + Intergenic
1177836958 21:26195242-26195264 AAGGGCACCAAGAAAAATGAAGG + Intergenic
1178003142 21:28186750-28186772 CAGAGCTAAAATCAAGATGATGG + Intergenic
1178114892 21:29407112-29407134 CAGGGCACTAAGTAAGGTGATGG + Intronic
1181287222 22:21762102-21762124 CAGGGCAAGAATAGAGATGTGGG + Exonic
1181730478 22:24842730-24842752 CAGGGCCAAAATAACGGTGATGG + Intronic
1181907315 22:26209691-26209713 GAAGGAAAAAAGAAAGAGGAAGG + Intronic
1182888063 22:33792878-33792900 CACGGGAAAAAGAAAGGAGAAGG + Intronic
1183091095 22:35522726-35522748 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1183197164 22:36361387-36361409 CAGGAAACAATGAAAGATGATGG + Intronic
1183292571 22:37011903-37011925 AAGGCCACACAGAAAGATGAAGG + Intronic
1183642337 22:39100237-39100259 AAGGGGAAAACCAAAGATGAAGG - Intronic
1184503153 22:44885919-44885941 CAGGCCTTAAAGAAAGACGAGGG - Exonic
1184533793 22:45072751-45072773 GAGGGCAAATGGAGAGATGAGGG - Intergenic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
949333000 3:2943085-2943107 TAGGGCAAAGAGAAACGTGAGGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949595860 3:5547002-5547024 CAAGGCCACAAGAAACATGATGG - Intergenic
950168736 3:10821341-10821363 CATGGCAAATAGAATGATGATGG + Intronic
951204624 3:19912394-19912416 CAGGCCAAAAAAAAAGCAGAGGG + Intronic
952322881 3:32294684-32294706 CAGGGCAGAAAACAAGAAGACGG - Intronic
952433080 3:33244871-33244893 CTGGGAAAAAAACAAGATGAGGG + Intergenic
952523526 3:34185903-34185925 CAGGGGAAAAAGAGAGAAAAAGG + Intergenic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952993314 3:38852376-38852398 AAGGGCAAAAAGAAATATGAGGG + Intronic
953505212 3:43479558-43479580 GAGGGAAAAAGGAAAGTTGAAGG + Intronic
953637893 3:44678001-44678023 CAGGGCAATGAGGTAGATGATGG + Intergenic
954095269 3:48321125-48321147 CAGCGAAAAAGGTAAGATGAGGG + Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954856977 3:53652523-53652545 TAGGGAAAAGAGAAAGATCAGGG + Intronic
955125887 3:56111643-56111665 CAGGGAGAAAACGAAGATGATGG + Intronic
955575045 3:60351980-60352002 CAGGGCAAGAAGTGAAATGATGG - Intronic
956908260 3:73789775-73789797 CAGGGCATATAGATAGATGTTGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958949515 3:100401235-100401257 CGGGGCGAAAAGAAAGAAAAAGG - Exonic
959128946 3:102327874-102327896 AAGGGCAAAAAGAAACTTCAGGG - Intronic
959302751 3:104623409-104623431 GATAGTAAAAAGAAAGATGAGGG + Intergenic
959354072 3:105303471-105303493 TAGGCCAAAAAGAAAGAGAAAGG - Intergenic
959434274 3:106294840-106294862 AAGAGAAAAAAGAAAGATGTGGG - Intergenic
959559005 3:107758295-107758317 CAGGCAAAAAAGAAAACTGAAGG + Intronic
959701498 3:109303227-109303249 CAGGGAAATAAAAAATATGATGG - Intronic
959807129 3:110568918-110568940 CAAAGAAAAAAGAAAGATTAAGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
960029420 3:113042371-113042393 CTGGGGACAAATAAAGATGAAGG - Intergenic
960444401 3:117729939-117729961 CAGAGCAAAAGGAAAGATAGAGG + Intergenic
960632557 3:119747201-119747223 CAGGGCAGAAATAGAGAAGATGG + Exonic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
962006840 3:131358233-131358255 CAAGGGAAAAAGAAATATGGTGG - Intergenic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
962625643 3:137223363-137223385 CAGGGAGAAAAGAAAGCAGAAGG - Intergenic
963025559 3:140915473-140915495 CAGGGAAGAAAGAAAAGTGAAGG - Intergenic
963658276 3:148088182-148088204 CATGGCCACAACAAAGATGATGG + Intergenic
964998265 3:162916499-162916521 CTGAGCAAAAATAAAGCTGAAGG - Intergenic
966043183 3:175517737-175517759 CATAGGAAAAAGAAAGATAAAGG + Intronic
967216076 3:187211707-187211729 CTGGGGGAAAAAAAAGATGAAGG + Intergenic
967313432 3:188128045-188128067 CAAAACAAAAAGAAAGATGGGGG + Intergenic
967385764 3:188909313-188909335 CAGGACAAAAAAGAACATGATGG + Intergenic
967621134 3:191635246-191635268 AGGGACTAAAAGAAAGATGAGGG - Intergenic
968810743 4:2798702-2798724 CAGGGCAGAGGGGAAGATGACGG + Intronic
970072840 4:12181692-12181714 CAGAGCAAAAAGGTAGAGGAGGG + Intergenic
970202384 4:13623132-13623154 TATGGAAAAAAGCAAGATGAGGG - Intronic
970291734 4:14580427-14580449 CAGAGCAAAAAGAAAAACCATGG + Intergenic
970338458 4:15079246-15079268 CGTGGCCAAAATAAAGATGACGG + Intergenic
971172073 4:24243582-24243604 CATGGCAAATAGAAAGAGTAGGG + Intergenic
971867002 4:32185313-32185335 CAGGGCAAACAGAACTATGCAGG - Intergenic
973304697 4:48632856-48632878 CAGGGCAGGAAGAAAGTTGAAGG - Intronic
974584103 4:63847059-63847081 CAGGGCAATTAGACAGAAGAAGG - Intergenic
975096209 4:70460400-70460422 AAGAGCAAAAAGAAAGGTGATGG + Intronic
975190876 4:71460647-71460669 CAGGGGAAATAAAAAAATGAGGG + Intronic
975229654 4:71917033-71917055 AAAGGGAAAAAGAAAAATGAAGG - Intergenic
975476221 4:74826211-74826233 CAGGGCAAAAGTAAAAATGGAGG + Intergenic
975497308 4:75048748-75048770 CATGGCAAAGAGAGAGATGTGGG + Exonic
975623044 4:76313658-76313680 AAGGACACAAAGATAGATGAAGG + Intronic
976036234 4:80824547-80824569 AAGGGGAAAAATAAAAATGAAGG - Intronic
976135136 4:81927498-81927520 AAGGCAAAAAAGAAAGATAAAGG - Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976465584 4:85365070-85365092 CATGTCAAAATAAAAGATGAAGG - Intergenic
976947298 4:90786143-90786165 CTGGGCAGATAGAAAGACGATGG + Intronic
977925158 4:102692315-102692337 TAGGGAAAGAAGAAAGATGAGGG + Intronic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978215879 4:106202399-106202421 TAGCACAAAAAGAAAAATGAAGG - Intronic
978394020 4:108258648-108258670 CAGGGAAAAGAGGAACATGATGG + Intergenic
979247276 4:118522271-118522293 GAGGTAAAAAAGAAAGATAATGG - Intergenic
980426477 4:132633272-132633294 CAGGGCAATTAGACAGAAGAAGG - Intergenic
981347887 4:143697737-143697759 CATGGCAAAAGGAAGGATGTAGG - Exonic
981373468 4:143987125-143987147 CAGGCCAAAAAGCAACATTAAGG - Intergenic
981427934 4:144625345-144625367 GTGGGCAAAAAGAATGATCAAGG + Intergenic
981444642 4:144821594-144821616 CAGTGCAATAAGAAAGAAAAAGG + Intergenic
981491214 4:145341503-145341525 CAAAGCAAAAAAAAAGAGGAAGG + Intergenic
981820178 4:148878896-148878918 CAGGGCAAAGAAAAAAATAATGG - Intergenic
982092600 4:151893286-151893308 AAAGTAAAAAAGAAAGATGATGG + Intergenic
982405707 4:155017678-155017700 CAGAGCAAAAAGGAAAGTGAAGG + Intergenic
982716004 4:158808927-158808949 CAGTGCAGAAAGAAACATGTTGG + Intronic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984562784 4:181290737-181290759 CAAGGAAGAAAAAAAGATGAAGG - Intergenic
984611767 4:181848460-181848482 CAGTGCAATATGAAGGATGATGG + Intergenic
985047848 4:185958306-185958328 CATGGCAAAAAGTAAACTGATGG + Intergenic
985387384 4:189461949-189461971 AAGGCCAAAAAGAAATATGCGGG + Intergenic
986353986 5:6906204-6906226 GAGGGCAAGAAGCAAGAAGACGG - Intergenic
987293345 5:16528520-16528542 CAGGAGCAAAAGAAAGATTAGGG + Intronic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988574597 5:32409428-32409450 CTGGGCAAAAAAAAAAATGGGGG - Intronic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
988951365 5:36264901-36264923 ACCTGCAAAAAGAAAGATGAGGG + Intronic
989317562 5:40100425-40100447 AATGGCAAAAAGAAAGATGATGG - Intergenic
989350815 5:40484519-40484541 CAGGAAAAAAAGACAGATTATGG + Intergenic
989677563 5:43989543-43989565 CAGGACAAAAGGAAAAATTATGG - Intergenic
990004418 5:50929333-50929355 CAAGACAAAAAGAAAGAGAAAGG - Intergenic
990415735 5:55584875-55584897 CAGGGCAAGAATACAAATGAAGG + Intergenic
990691703 5:58371436-58371458 CGGGGCAAAAAAAAAGAAAAGGG + Intergenic
990900788 5:60746828-60746850 TATAGGAAAAAGAAAGATGAGGG + Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991272286 5:64798355-64798377 CAGGACAAGAAGAAAGATGGTGG - Intronic
991344260 5:65645918-65645940 CAAGGCAAAAAAAAAATTGAGGG - Intronic
991973686 5:72165141-72165163 CAGGGGACCAAGAAAGATTAAGG - Intronic
992089935 5:73307746-73307768 CAGGGCAAAAGGAAAATTGCAGG - Intergenic
992492888 5:77262203-77262225 CAGGGCAAAAAGGCAGAAAATGG + Intronic
992711091 5:79457022-79457044 CAGGGCAGAAAAGAAAATGATGG + Intronic
992751525 5:79867148-79867170 GAGACCAAAAAGAAAGATGGAGG - Intergenic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993649923 5:90507943-90507965 AATGGCAAAAAAGAAGATGAAGG - Intronic
993775230 5:91986635-91986657 TAGGGCACAGAGAAAGGTGAAGG - Intergenic
993835303 5:92812503-92812525 CAGAGAAGAAAGAAAGATAAAGG + Intergenic
993958753 5:94270463-94270485 CTGAGCAAAAAGAACGATGAGGG + Intronic
994669294 5:102747280-102747302 AAGAGCAAAAAGAAAGGTGTGGG - Intergenic
994776419 5:104040209-104040231 TAGGACAAAAAGGCAGATGAAGG + Intergenic
994869036 5:105319960-105319982 TAGAACAAAAAGAAAGATAATGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995900038 5:117054863-117054885 CAGAGCAAAATGCAAGATGGGGG - Intergenic
995929727 5:117425265-117425287 CATGGCACCAAGAAAGATGGAGG - Intergenic
996074062 5:119168866-119168888 CAAGACAAAAGGAAAGAGGAAGG - Intronic
996262560 5:121491197-121491219 CTAGGCAATAAGAAAGATGCAGG - Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
997232583 5:132255378-132255400 CAGGGGAAAAGGAAATCTGAGGG + Intronic
998736147 5:145143447-145143469 CTGGGGAAAAAGTAAGCTGAAGG - Intergenic
998844402 5:146292845-146292867 AAGTGCAAAAAGAAAGATTGGGG + Intronic
999870977 5:155750926-155750948 CTGGGGCAAAAGAAAGATGGTGG + Intergenic
999934964 5:156476434-156476456 CAGGTAAAAAATAAAGATTATGG - Intronic
1000128311 5:158269244-158269266 AAGGGCAAAAAAAAAGGTGTAGG + Intergenic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000509057 5:162159686-162159708 CAGAGCCAGAGGAAAGATGAAGG - Intergenic
1001054196 5:168435833-168435855 AAAAGAAAAAAGAAAGATGAGGG - Intronic
1001232686 5:170002924-170002946 CAGGGCAGAAAGAAAAATCTGGG + Intronic
1001302458 5:170544837-170544859 CAGCACAAAAAGAAAGAAGTGGG - Intronic
1001637964 5:173226270-173226292 CAGGCCAAGAAGAAAGCTGCTGG - Intergenic
1003799595 6:9648621-9648643 CAGGGCTTGAAGAAAGATAATGG - Intronic
1003906901 6:10709509-10709531 CAGGGAAAAAAAAAAAATTAAGG - Exonic
1004171369 6:13297830-13297852 AAGGGCAGTCAGAAAGATGATGG + Intronic
1004185536 6:13418252-13418274 AAGGGACAAAAGAAAAATGAAGG + Intronic
1004329432 6:14708135-14708157 AAGGGAAAAAAAAAAGATAAGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004979568 6:21008207-21008229 GGAGCCAAAAAGAAAGATGAGGG + Intronic
1005088490 6:22032037-22032059 GAAGGCAAAAAGAAATAAGATGG - Intergenic
1005286487 6:24333084-24333106 AAAGGCAAAAAGAAGAATGAGGG + Intronic
1005983789 6:30857389-30857411 CGAAGCAAAAAGAAAGCTGAAGG - Intergenic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006303194 6:33204817-33204839 CAGGGCAGAAAGTAAAATGTGGG - Intronic
1007058999 6:38919439-38919461 CAGTGCAAAATGAAAAATGTGGG - Intronic
1007385524 6:41517952-41517974 TAATACAAAAAGAAAGATGATGG + Intergenic
1008320767 6:50110814-50110836 CTCAGGAAAAAGAAAGATGAGGG - Intergenic
1009287537 6:61839832-61839854 CAGGTAAGAAAGAAATATGAAGG + Intronic
1009429361 6:63549138-63549160 CTGGCCAAAAAGAAAGCTGCTGG - Intronic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1010042546 6:71403123-71403145 GGGGGAAAAAAGTAAGATGAAGG - Intergenic
1010174238 6:73007892-73007914 AAAGGAAAAAAGAAAAATGAAGG - Intronic
1010275446 6:73963420-73963442 AAGGGGAAAAATAGAGATGAGGG + Intergenic
1011240897 6:85270365-85270387 CAGAGGAAAAGGAATGATGATGG - Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011591302 6:88972810-88972832 CTGGGCAAAAAGAAAAAAAAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012159011 6:95859506-95859528 GAGGGCAAAAATAATGATGCTGG + Intergenic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1013476511 6:110511974-110511996 CAGGGAAGAAAGCAAGATGTAGG - Intergenic
1013623881 6:111918300-111918322 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1013726814 6:113108110-113108132 GAGGGCAAAAGGCAAGAGGAGGG - Intergenic
1013869069 6:114735127-114735149 CAGGGCTAAAGGAAAGGAGATGG - Intergenic
1014360932 6:120472655-120472677 CCTGGCAAAAAGAAAGAAGGAGG - Intergenic
1015113359 6:129619268-129619290 GAGGGGGAAAAGAAAGAGGAGGG + Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015616275 6:135078687-135078709 TAGGGCAAAAAGAAAGACATGGG + Intronic
1015697016 6:135991744-135991766 GAAGGCAGAAAGAATGATGAGGG + Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016561667 6:145401766-145401788 CAGGGCTTAAAGAATGATCATGG + Intergenic
1016759938 6:147725836-147725858 CAGGACAAAAGGAGAAATGATGG + Intronic
1017031212 6:150224282-150224304 CAGGACAAAAATAAAGGTGGAGG - Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017347997 6:153406772-153406794 TAGGGAAACAGGAAAGATGAAGG - Intergenic
1017869936 6:158478754-158478776 CAAGGGAGAAAGAAAGGTGAAGG - Intronic
1018138759 6:160805899-160805921 TAGGGAAATAGGAAAGATGAAGG + Intergenic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1019818397 7:3218383-3218405 CAGGGCAAAAGGAAGGTTGCGGG - Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020260551 7:6528566-6528588 CAGGGCCAAGGGCAAGATGAGGG + Intronic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1021481347 7:21121096-21121118 GAGGGCAAGAAGAGAGAGGAAGG - Intergenic
1021626545 7:22599082-22599104 CAGGCCAGACAGGAAGATGAGGG + Intronic
1022491473 7:30823423-30823445 CAAGGAAAAGAGAAAGAAGATGG - Intronic
1023181376 7:37487110-37487132 CTGGGCAAAATGAAATTTGATGG + Intergenic
1023241153 7:38149089-38149111 GAAGGAAAAAAGAAAGAAGAAGG + Intergenic
1023478184 7:40603968-40603990 CTGGGGATAATGAAAGATGAAGG - Intronic
1023759973 7:43456260-43456282 AAAGGCAAAAAGAAAAATCAAGG - Intronic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1024147189 7:46529690-46529712 CAGGACCGAAAGAAAGATAAGGG - Intergenic
1024785081 7:52898196-52898218 AGGGGCAGAAAGAAAGTTGAGGG + Intergenic
1024944608 7:54796245-54796267 CAGGGCATAGAGAAAGCAGAGGG + Intergenic
1026400016 7:70000628-70000650 CAGTTCAAATATAAAGATGATGG - Intronic
1026461899 7:70621706-70621728 CAGAGCAAAAGCAAAGATTAAGG + Intronic
1027380912 7:77608651-77608673 CAGGGAAAAAAGAGAAATAAGGG - Intronic
1027928448 7:84498813-84498835 CAGGGCAGAAAGTAAGAAGATGG - Intergenic
1028471870 7:91214441-91214463 CAGGGTAAAAGCAAAAATGAAGG + Intergenic
1028765110 7:94546913-94546935 TAGGGCAAAAAGAAAAACAAAGG - Intronic
1028777933 7:94701660-94701682 CAGGGCAACAGGAAATAGGAAGG - Intergenic
1029408809 7:100395397-100395419 CACAGCAAAAAGCAAGATGCTGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1030931533 7:115529179-115529201 TAGGGAAAAAAGAAACAAGAGGG + Intergenic
1030953760 7:115825147-115825169 CATGGCAAAAAGAGACAAGAGGG + Intergenic
1031512630 7:122668864-122668886 CAGAGCAAAATGAAAGAGTAAGG - Intronic
1031871460 7:127092706-127092728 CAGGGGGAAAAGAAAAAAGAAGG + Intronic
1032072383 7:128816247-128816269 CAGTGCCAAAAGAGGGATGAGGG - Intronic
1032204535 7:129850508-129850530 AAGGGCAATATGAAAGATGCAGG + Intronic
1032205254 7:129858656-129858678 CTGGGTAACAAGAAAAATGAAGG + Intronic
1032377137 7:131431600-131431622 CAGGGCAAGAAAAAAATTGATGG - Intronic
1032502598 7:132411030-132411052 CATGGAATAAAGAAACATGAGGG + Intronic
1033020608 7:137720646-137720668 CAGGGCAAAATTAAATATGAAGG - Intronic
1033265095 7:139878449-139878471 AAAGGAAAAAAGAAAGGTGATGG + Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033727790 7:144138645-144138667 CAAGGTAAAATCAAAGATGAAGG - Intergenic
1033801615 7:144908607-144908629 CAGGGCAAAAAGCAAAGGGAGGG + Intergenic
1033801721 7:144909442-144909464 AAGGGCAAAAAGAAAGCAGCTGG - Intergenic
1033867146 7:145704707-145704729 GAAGGCAAATAGAAAGAGGATGG - Intergenic
1033873717 7:145788597-145788619 CAGGGAGCCAAGAAAGATGAAGG - Intergenic
1034791829 7:153977534-153977556 CAGGACAAAAAGAAAGAATGAGG - Intronic
1035793461 8:2330486-2330508 CAGGGAAATAAGAAAAAAGATGG - Intergenic
1035799343 8:2391219-2391241 CAGGGAAATAAGAAAAAAGATGG + Intergenic
1036124470 8:6050190-6050212 CAGGGCAGCAAGAGAGATAATGG + Intergenic
1036173236 8:6510583-6510605 CAGTGCCAAAACAAAGATGGCGG - Intronic
1036505958 8:9356293-9356315 GAAGGCAAAAAGAAAGAGCAGGG - Intergenic
1036728127 8:11238451-11238473 CAGGCCGAAAATAAAGTTGAAGG + Intergenic
1037836241 8:22216302-22216324 CAGGTTAAAATGAAAGATGCTGG + Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038588480 8:28812885-28812907 TAAGGAAAACAGAAAGATGATGG + Intronic
1039335808 8:36587938-36587960 CAAGACAAAAAGAAACCTGAGGG - Intergenic
1039453258 8:37692627-37692649 CTTGGCACAAAGAAAGTTGAAGG - Intergenic
1039648381 8:39312437-39312459 CAGGGCAAATGGAAAGTTAATGG + Intergenic
1039683254 8:39765609-39765631 AAAGGCAGAAAGAAAGAAGAGGG - Intronic
1040693774 8:49971512-49971534 CAGGGCAAATAGGCAGAAGAAGG + Intronic
1041397031 8:57401919-57401941 CAGGGGAGAATGAGAGATGAGGG + Intergenic
1041571875 8:59346440-59346462 CCTGGGAAAAAGAAAAATGAAGG + Intergenic
1041985413 8:63916741-63916763 GAGAGAAAAAAGAAAGATGTAGG - Intergenic
1042182107 8:66100792-66100814 AAGGGAAAAAAAACAGATGAAGG + Intergenic
1042461056 8:69069349-69069371 CTTGGGAAAAAGAAAGATGAAGG - Intergenic
1042469774 8:69172820-69172842 CAAGGCAATAAGAAAGAAAAGGG - Intergenic
1042745182 8:72099451-72099473 CTGGGCAACAAGAAAGAGGGAGG - Intronic
1042886449 8:73557826-73557848 CAGGGACAAAAGATAGATGATGG - Intronic
1043155051 8:76768480-76768502 AGGGGGAAAGAGAAAGATGAGGG + Intronic
1043221134 8:77665921-77665943 CAGGGCAGCAAGAAAGTTAAGGG + Intergenic
1044381515 8:91539621-91539643 AAGGGGGAAAAGAGAGATGAGGG - Intergenic
1045235307 8:100347456-100347478 CAGGGATGAATGAAAGATGAAGG + Intronic
1046509280 8:115179413-115179435 AATGGCAAAAATAAAGATGACGG + Intergenic
1046614280 8:116458987-116459009 CAGGGCCTGAAGAAAGATGCAGG - Intergenic
1046625130 8:116568757-116568779 CAAGGAAAAAAGAGAAATGATGG + Intergenic
1046749470 8:117911739-117911761 CAGTTCAAAGTGAAAGATGAGGG - Intronic
1047018067 8:120744973-120744995 CAGGACATCAAGAAAGACGATGG - Intronic
1047926285 8:129686091-129686113 CATGGCATAAACAAGGATGATGG + Intergenic
1048158534 8:131988909-131988931 CAGGGTAAAAAGAAATAACAGGG - Intronic
1048272863 8:133043426-133043448 CAGGTAAAAACGAAAGAGGAAGG - Intronic
1048277623 8:133078924-133078946 CAGGGTGTAAAGAAAGATGTCGG + Intronic
1048374216 8:133808183-133808205 CAGCGGAAAAAGGAAGTTGAGGG + Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1048955634 8:139533794-139533816 CAGGGCCAGAAGTAAGTTGAGGG + Intergenic
1049984997 9:942050-942072 CAGAGAATAAAGGAAGATGATGG - Intronic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050554893 9:6780937-6780959 CAAGGCCCCAAGAAAGATGAAGG - Intronic
1050871555 9:10577534-10577556 CTGGGTGAAAAGAAAGATGTTGG - Intronic
1051381103 9:16459464-16459486 CTGGGCAAAATGAAACATGGTGG + Intronic
1051385096 9:16499469-16499491 CAGTGCAAATGGAAAGATAAGGG - Intronic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1052087717 9:24288913-24288935 CTGGGCAAAAAGAAATAAAATGG - Intergenic
1052255560 9:26452361-26452383 CAGAGCAAAAAGAAAAAAGCTGG - Intergenic
1052271958 9:26636434-26636456 CAGGGCCAAAAGAATGTGGAAGG - Intergenic
1052549291 9:29927644-29927666 CACAGCTAAAAGAAAGATGCTGG + Intergenic
1053026795 9:34736236-34736258 CCAGGAGAAAAGAAAGATGATGG + Intergenic
1053898943 9:42773651-42773673 CAGTGGAAAAAGAAAGTTGGAGG - Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054867070 9:70013584-70013606 AAAAGCAGAAAGAAAGATGAGGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1056128509 9:83561653-83561675 AAGGGCAAAATGAAAGAATATGG + Intergenic
1056879332 9:90375742-90375764 CAAGGGAAAAAGAAAAAAGACGG + Intergenic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1058273632 9:103008933-103008955 CAGAGCAAAAGAAAAGTTGATGG - Intronic
1058320380 9:103622595-103622617 GAGGGGGAGAAGAAAGATGAGGG - Intergenic
1058422904 9:104850082-104850104 CACGGCAAAATGATGGATGATGG + Intronic
1058550070 9:106105355-106105377 GAGGGATAAAAGAGAGATGAGGG - Intergenic
1058787074 9:108399749-108399771 CAGGGGGAAAAGGAAGATAACGG + Intergenic
1058797499 9:108512787-108512809 CATGGCAAAAAAAAAAATTAGGG + Intergenic
1059136081 9:111807805-111807827 CAGGCCAAAGAGACAGATCAAGG - Intergenic
1059548206 9:115200555-115200577 TAGGGAAAAAAGAAAAAAGAAGG - Intronic
1059761132 9:117338746-117338768 AATGGCAAAAAAAAAGATAATGG - Intronic
1059814832 9:117900619-117900641 CTGAGCAAAAAGTAAGATGTTGG + Intergenic
1060110778 9:120904912-120904934 CAGGGCACAAAGATGGGTGAAGG - Exonic
1060762247 9:126264600-126264622 GATGGAAAAAAGAAAGATGCAGG - Intergenic
1061692370 9:132343955-132343977 CATGGCCAAAAAAAAGATGAGGG + Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185537884 X:876623-876645 CAGGTCAAAAAGAAAGCTTTTGG - Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1186359771 X:8828283-8828305 CAAAGAAAAAAGAAATATGAAGG + Intergenic
1186603924 X:11069005-11069027 CAGTGGAAAAAAAAAGAAGAAGG + Intergenic
1187101015 X:16191990-16192012 CAAGGCAAAAGGAAAAAGGAAGG - Intergenic
1187869537 X:23753087-23753109 CAGTACAAAAAGAAAGAAAAAGG + Intronic
1188067963 X:25684746-25684768 CAGGGAAAAAAAAAAGATTTAGG - Intergenic
1188793986 X:34440238-34440260 CAAAGCAAAAAGAAAGAAGCTGG + Intergenic
1189461904 X:41250043-41250065 CAGGGCAGGAAGCAAGAGGAGGG - Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189933811 X:46043513-46043535 TAGAGCAAAAAGGAAGAGGAAGG + Intergenic
1190025202 X:46915655-46915677 CAAGGCAAAAATAACCATGAGGG - Intronic
1190621393 X:52290011-52290033 CTGGGCAAAAAGAAAAAAGCTGG - Intergenic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193223196 X:78951647-78951669 CAGGTAAAAAAGGAATATGATGG + Intronic
1193225440 X:78977204-78977226 CTGGGCAAATAGCAAAATGAAGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194940947 X:100009472-100009494 TAGGGAAAATAAAAAGATGAGGG - Intergenic
1195307612 X:103600714-103600736 CAGTGAAAATAAAAAGATGAAGG - Intergenic
1195470483 X:105224110-105224132 CAGGACAAAAAAACAGAGGAAGG + Intronic
1195475768 X:105283440-105283462 CAGCTATAAAAGAAAGATGATGG + Intronic
1195570876 X:106397435-106397457 CAGGAGCAAAAGAGAGATGAGGG - Intergenic
1196185599 X:112741702-112741724 AGGGGCATAAAGAAAGATTATGG - Intergenic
1196292690 X:113961679-113961701 CAGGGGAAAAATAAAAATAATGG - Intergenic
1196814255 X:119652631-119652653 CAGGGCAGAAAGACAGCTCAGGG + Intronic
1197261021 X:124318184-124318206 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1197634948 X:128904204-128904226 CAGGGAGGAAAGAAAAATGAGGG + Intergenic
1198080616 X:133235957-133235979 CAGAGCAACAGGAAAGAGGAAGG - Intergenic
1198143419 X:133829780-133829802 CAGAGCAAAAAGAATTATCAGGG + Intronic
1198383359 X:136105001-136105023 AAGGAAAAAAAGAAAGATGGAGG + Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198882788 X:141299247-141299269 CAGGGAACAATAAAAGATGAAGG - Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1199058975 X:143330513-143330535 CTGGGCAAAAAGAAAAAAGAGGG - Intergenic
1199662054 X:150061474-150061496 AATGGCAAAAAGAAAGAAGGAGG - Intergenic
1199735860 X:150686137-150686159 CAGGGCAAAATGAAAAATGCAGG - Intergenic
1201041665 Y:9839717-9839739 CAGGGCAATTAGAAAGGAGAAGG - Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201236594 Y:11917850-11917872 CAGAGCAAAAGGAAAGGAGAAGG + Intergenic
1201594282 Y:15650570-15650592 CAGGGCGAAAAGAAAGATGAAGG - Intergenic
1201595200 Y:15660495-15660517 CATGGCACAAAGCAAGAAGAAGG - Intergenic