ID: 1191731780

View in Genome Browser
Species Human (GRCh38)
Location X:64344045-64344067
Sequence CAGAGTTAGCATAAGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191731780 Original CRISPR CAGAGTTAGCATAAGTGGGT GGG (reversed) Intronic
902070796 1:13734950-13734972 CAGAGTTGGAATAAGTTAGTAGG - Intronic
906387317 1:45381642-45381664 CAGAGTTAGCTGAACTGAGTGGG - Intronic
910697981 1:90041823-90041845 CTGAATTGGAATAAGTGGGTTGG + Intergenic
916092800 1:161321467-161321489 AAGAGTTTGCAGATGTGGGTTGG - Intronic
918754108 1:188314479-188314501 CAGATTTAGCATTTGTGTGTGGG + Intergenic
919207680 1:194437803-194437825 CAGAGGCAGCATAACTGGGGTGG - Intergenic
921169535 1:212534184-212534206 CAGAGTTTGCATAAGTGTGCAGG - Intergenic
922114695 1:222601418-222601440 CTCAGTAAGAATAAGTGGGTGGG - Intergenic
922225667 1:223644160-223644182 CAGAGTTAAAACAACTGGGTTGG - Intronic
922657317 1:227397027-227397049 CATAGTGAGCATAAGAGGGAGGG - Intergenic
1063130588 10:3173501-3173523 CAGGGCTGGCAGAAGTGGGTGGG + Intergenic
1068473939 10:57501531-57501553 CAGGGTTAGGGTATGTGGGTTGG - Intergenic
1071710139 10:88041978-88042000 CAGAGGTTGCACAGGTGGGTGGG + Intergenic
1075732866 10:124646693-124646715 CAGAGTTCACATAAGGGGGTTGG - Intronic
1077600662 11:3572369-3572391 CAGAGTTAGTACAAGAGGGCCGG - Intergenic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1088223736 11:107595708-107595730 CATGGTCAGCATAAGTGAGTTGG - Intronic
1089827928 11:121295750-121295772 CAGAGCTAGCAGATTTGGGTAGG - Intronic
1092782103 12:11996688-11996710 CAGCATTAGCATTAGAGGGTGGG - Intergenic
1095107070 12:38247285-38247307 CAAAGTTAGCCTAAATTGGTAGG + Intergenic
1101159721 12:101961154-101961176 CAGAGTTTGCATAGATGGGCTGG - Intronic
1103040517 12:117691423-117691445 GAGAGTTTGCCTAAGTGGGAGGG - Intronic
1103181519 12:118916180-118916202 CAGAGTCTGCATAAGAGGGGTGG - Intergenic
1106125042 13:26894317-26894339 CTGAGGTAGCAGAAGTAGGTCGG + Intergenic
1107900160 13:45004476-45004498 CAGAGCTAGTATAAGTTGGCTGG + Intronic
1109881158 13:68478849-68478871 TAGAAATAGGATAAGTGGGTTGG + Intergenic
1110463918 13:75779289-75779311 AAGTATTAGCATAATTGGGTTGG + Intronic
1111982778 13:95034407-95034429 AAGAGTTGGCAGAAGCGGGTAGG - Intronic
1112526888 13:100158078-100158100 CACACTTAGCCTAAGTGTGTGGG - Intronic
1113135310 13:107082389-107082411 CAATGTTAGAATAAGTGGGATGG + Intergenic
1118158116 14:63261397-63261419 CAATGTTAGCATAGGTGGTTAGG - Intronic
1127411813 15:58715706-58715728 GAGAGTTTGCATGAGTGAGTGGG - Intronic
1130049064 15:80468199-80468221 CAGAGTTATCCTTTGTGGGTGGG + Intronic
1131120135 15:89817197-89817219 CAGAAATAGCCTAAGTGGGCTGG + Intergenic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133876640 16:9741011-9741033 CAGGGTCAGCTTGAGTGGGTGGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1140964863 16:79955809-79955831 CAGCTTTAGCATAAGTAGTTTGG - Intergenic
1143737315 17:8921530-8921552 CAGAGTTAGGTAAAGTGGTTAGG + Intronic
1145823430 17:27858214-27858236 CAGACTTGGAATAAGTTGGTTGG + Intronic
1151803640 17:76391992-76392014 GAGAGGTAGCAGAAGTGGGGGGG + Exonic
1152338570 17:79711643-79711665 CACACTTAGCATCAGAGGGTGGG + Intergenic
1158222242 18:55161643-55161665 CAGTGTTAGGATAAGAGGGCAGG - Intergenic
1158589322 18:58766462-58766484 CAGAGTTAGTAAAAGTGGACTGG - Intergenic
1161271914 19:3394527-3394549 CAGACTTAGTGTAAGCGGGTGGG - Intronic
1162569015 19:11460109-11460131 CAGAGTTGCCATTAGTGAGTTGG - Intronic
1163969790 19:20781037-20781059 CAGATTTAGCATCTGTGGATGGG - Intronic
1166431880 19:42734846-42734868 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166434996 19:42760063-42760085 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166447842 19:42873826-42873848 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166470721 19:43077409-43077431 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166481834 19:43180939-43180961 CAGAGTTAGGAAAAATGGGGAGG + Intronic
1166484305 19:43200057-43200079 CAGAGTTAGGAAAAATGGGGAGG + Intronic
925950723 2:8907916-8907938 CAGTGTAAGGATAAGTGTGTTGG - Intronic
926813129 2:16774155-16774177 CAGAGTCTGCTTCAGTGGGTTGG + Intergenic
928392542 2:30920515-30920537 CAGTGTTAGCAGAAGGGGTTGGG + Intronic
929019021 2:37531920-37531942 CAGAGTTAGAATAAGTACTTTGG - Intergenic
940189673 2:151027239-151027261 CAGTGTTAGCAAAAGTGCGCTGG - Intronic
945440060 2:209867654-209867676 AAAAGTTGGCACAAGTGGGTCGG - Intronic
945836328 2:214839749-214839771 CAGATTTCTCATAAATGGGTTGG - Intergenic
948689373 2:239692237-239692259 CTGGGTTTGAATAAGTGGGTGGG - Intergenic
1169868923 20:10230884-10230906 CAGAGTGAGGACAAGTGTGTGGG + Intronic
1174200467 20:48803334-48803356 CAGAGCCAGCATATGCGGGTGGG + Intronic
1177378787 21:20310276-20310298 CTGAGTTACCATAAGTGACTTGG + Intergenic
1178137059 21:29639487-29639509 CAGAGTTAAAATAATTTGGTAGG + Intronic
1178267481 21:31157509-31157531 CTGAGCTGGAATAAGTGGGTTGG - Intronic
1179952244 21:44715021-44715043 CAGAGTTAGCAGACCTGGGATGG - Intergenic
1181402572 22:22660321-22660343 GAGTTTTAGCATAATTGGGTGGG - Intergenic
1183374974 22:37457800-37457822 GAGACTTAGCATATGTGGGAGGG + Intergenic
953839178 3:46374950-46374972 CAGAGTCAGCAGAACTGGGGTGG + Exonic
956925218 3:73979714-73979736 CAGAGGTAGGCAAAGTGGGTTGG - Intergenic
957702105 3:83727519-83727541 GAGGGGAAGCATAAGTGGGTTGG - Intergenic
959897333 3:111619240-111619262 CAGTGATAGCATAAAAGGGTGGG + Intronic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
961430533 3:126879284-126879306 TAGAGTTAGGACATGTGGGTTGG + Intronic
969156623 4:5216729-5216751 CTGAGCTAGCTTAAGAGGGTTGG + Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
970272791 4:14365267-14365289 CAGAGCTGGCAGAACTGGGTGGG + Intergenic
972731029 4:41795432-41795454 CAGTCTCAGCATAACTGGGTTGG + Intergenic
973343646 4:49031334-49031356 CTGAGGGAGAATAAGTGGGTGGG + Intronic
976148583 4:82068838-82068860 CAGAATTAGCATAAGAACGTGGG + Intergenic
976217997 4:82732632-82732654 CTGAGGTAGAATAAGCGGGTTGG + Intronic
977169874 4:93749050-93749072 GTAAGTTAGCAAAAGTGGGTGGG + Intronic
978148142 4:105401951-105401973 TACAGTTAGCATAAATGGTTTGG - Intronic
978331861 4:107621943-107621965 CAGAGTGAGCACAAATGGCTGGG + Intronic
980722791 4:136719793-136719815 CAGGGTTAGTATAAAAGGGTAGG - Intergenic
982430008 4:155312159-155312181 CAGGGTCAGGATAAGTGGTTTGG + Intergenic
984253750 4:177365358-177365380 CAGAACTGGAATAAGTGGGTTGG + Intergenic
985386294 4:189451578-189451600 CAGAGTTTGCAAAAGTGTGAAGG + Intergenic
987100635 5:14588556-14588578 CTTAGTTAGCATAAGTGTGGTGG + Intronic
990492220 5:56313741-56313763 CAGAGTGAGAGTATGTGGGTGGG - Intergenic
998245425 5:140498278-140498300 CTGAGATAGCATAATTGGGATGG - Intronic
999478454 5:151923787-151923809 CAGAGTTTGGAAAGGTGGGTTGG + Intronic
1005441455 6:25873550-25873572 CAGAGTCAGCAGAAGATGGTAGG - Intronic
1005980247 6:30830969-30830991 GAGAGATGGCAGAAGTGGGTTGG + Intergenic
1006668231 6:35713154-35713176 TAGAGTGGGCATAAGCGGGTGGG + Intronic
1007267389 6:40607281-40607303 TAGAGTTAGCAGAAGGGGATTGG + Intergenic
1008359823 6:50602883-50602905 CAGAATTAGCTTAAGTGTCTGGG - Intergenic
1008414068 6:51218812-51218834 CTGAGTTAGGATAAGCTGGTTGG + Intergenic
1011329811 6:86191586-86191608 CAGTGCCAGCATGAGTGGGTAGG + Intergenic
1017020512 6:150136345-150136367 CAGAGTCCTCATAAGTGGATTGG - Intergenic
1021273670 7:18623646-18623668 AAGAGTTAGCATTGGTGGCTGGG + Intronic
1023197536 7:37657639-37657661 AAGAGTTAGCATTAATGGGTGGG - Intergenic
1023858566 7:44201693-44201715 CAGAGTCAGAATCACTGGGTGGG - Intronic
1036165982 8:6434091-6434113 CATAGTTGGCACAAGTGGGAAGG - Intronic
1036256856 8:7213090-7213112 CAGAGTTAGTACAAGAGGGTCGG - Intergenic
1036308906 8:7671689-7671711 CAGAGTTAGTACAAGAGGGTCGG - Intergenic
1036360634 8:8074422-8074444 CAGAGTTAGGACAAGAGGGTCGG + Intergenic
1036890336 8:12592544-12592566 CAGAGTTAGGACAAGAGGGTTGG - Intergenic
1037068576 8:14614756-14614778 GAGAGTTAACATAAGTGGTGGGG + Intronic
1037670700 8:21012975-21012997 CAGAGTTTGCATCACTGGGGAGG - Intergenic
1038274090 8:26105360-26105382 CTGAGCTAGAATAAGTGGGTTGG + Intergenic
1042335899 8:67630166-67630188 CTGAACTAGAATAAGTGGGTTGG - Intronic
1043692550 8:83173594-83173616 CTGGGTTGGCATGAGTGGGTAGG + Intergenic
1044354020 8:91199321-91199343 GAGAATGAGCTTAAGTGGGTAGG + Intronic
1046192176 8:110810516-110810538 CAGAGTTGGCATCAGTTCGTTGG - Intergenic
1048338025 8:133517500-133517522 CAAAATTAGCCAAAGTGGGTTGG - Intronic
1048661928 8:136614416-136614438 CATAGTTAGCATGAGAAGGTAGG - Intergenic
1050459846 9:5868249-5868271 CAGAGTTACCCTAAGTCGTTTGG + Intergenic
1050874962 9:10622970-10622992 CAGAGTTCTCATAAATGGGTTGG - Intergenic
1058422990 9:104851045-104851067 CACATTTTGCAGAAGTGGGTGGG - Intronic
1059146114 9:111901110-111901132 TAGAGATAGCATATTTGGGTTGG - Intronic
1060238272 9:121881898-121881920 CAGAGCCAGAATGAGTGGGTTGG + Intronic
1187245249 X:17548080-17548102 CAGAATCAGCATAGGTGGGGAGG + Intronic
1191731780 X:64344045-64344067 CAGAGTTAGCATAAGTGGGTGGG - Intronic
1193637351 X:83968934-83968956 CAGAGTTAGGAAAAGCGGGGGGG + Intergenic
1197941359 X:131793478-131793500 CAGACTTAGTCTATGTGGGTTGG + Intergenic
1199683409 X:150243064-150243086 CAGAGTCAGCATATATGAGTTGG + Intergenic