ID: 1191735105

View in Genome Browser
Species Human (GRCh38)
Location X:64380735-64380757
Sequence TAGGGTGGAAGGAGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21125
Summary {0: 1, 1: 17, 2: 469, 3: 8503, 4: 12135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191735105_1191735114 -10 Left 1191735105 X:64380735-64380757 CCCTCCCCCCTCCTTCCACCCTA 0: 1
1: 17
2: 469
3: 8503
4: 12135
Right 1191735114 X:64380748-64380770 TTCCACCCTACAACAGGCCCTGG 0: 2
1: 13
2: 314
3: 2877
4: 4706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191735105 Original CRISPR TAGGGTGGAAGGAGGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr