ID: 1191735339

View in Genome Browser
Species Human (GRCh38)
Location X:64382998-64383020
Sequence CTGTATTTAAGGGTGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191735339 Original CRISPR CTGTATTTAAGGGTGAAGCT TGG (reversed) Intronic
904420911 1:30390735-30390757 CTGTATTTATGTGTGAACCCAGG + Intergenic
905708515 1:40080909-40080931 CTGTATTAAAGGGTAAGGCCTGG - Intronic
907780056 1:57558671-57558693 CTGCATTTAATGTTGCAGCTTGG + Intronic
908544164 1:65148040-65148062 CTGGAGTTAAGGATGAAGGTGGG + Exonic
910639260 1:89442127-89442149 CTGCATTTAATGTTGCAGCTTGG - Intergenic
911883290 1:103268310-103268332 CTGCATTTAATGTTGAAGCTCGG + Intergenic
912252117 1:108021974-108021996 CTGCATTTAATGTTGCAGCTTGG - Intergenic
912583119 1:110737748-110737770 CTGAACTGAAGGGTAAAGCTAGG + Intergenic
913039624 1:115009782-115009804 CTGCATTTAATGTTGCAGCTTGG + Intergenic
917217501 1:172693072-172693094 CTGCATTTAATGTTGCAGCTTGG - Intergenic
917579744 1:176363516-176363538 CTCTATTTGAGTGTGAAGATGGG - Intergenic
921895157 1:220392007-220392029 CTGAATTTAAGGGTAAAACGTGG + Intergenic
923263269 1:232287732-232287754 CTTTCTCTGAGGGTGAAGCTGGG + Intergenic
1064517933 10:16170401-16170423 CTGTATTTAATGCTGCAGCTCGG - Intergenic
1068738153 10:60438273-60438295 ATGTATTGAAGAGTGAGGCTTGG + Intronic
1069192605 10:65508535-65508557 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1072209553 10:93233854-93233876 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1072733593 10:97864636-97864658 TTGTAGTTAAGGGTGAGCCTGGG - Intronic
1073557047 10:104463739-104463761 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1073957951 10:108893809-108893831 TTGTATTTAATGTTGTAGCTTGG - Intergenic
1074167991 10:110903007-110903029 ATGTATTTAATGGAGAGGCTAGG - Intronic
1078526679 11:12106743-12106765 CTATATTTAGGGATGAATCTGGG + Intronic
1080096674 11:28416559-28416581 CTGTATCTAAGAGTGAAACCAGG + Intergenic
1080976568 11:37349672-37349694 CTGCACTTAATGGTGCAGCTAGG + Intergenic
1081110181 11:39126211-39126233 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1081590096 11:44416628-44416650 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1081608748 11:44545670-44545692 CTGAATTTAATGTTGCAGCTTGG + Intergenic
1082093178 11:48105973-48105995 CTGTTTTCAAGGGTGAGGGTGGG - Intronic
1083481235 11:62949020-62949042 CTGGATTCTAGGGTGAAGGTGGG + Intronic
1084022008 11:66423305-66423327 CTGTAGTCAAGAGTGATGCTGGG + Intronic
1084655293 11:70511693-70511715 CTGTATGTAAGGGTGATGCATGG - Intronic
1085685675 11:78620004-78620026 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1085747288 11:79126058-79126080 CTGCATTTAATGTTGCAGCTTGG + Intronic
1088191969 11:107236685-107236707 CTGCATTTAAGGTTGGAGCTTGG - Intergenic
1088698297 11:112389223-112389245 ATCTAGTTAAGGGTGGAGCTGGG + Intergenic
1089903339 11:122011449-122011471 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1093098158 12:14995454-14995476 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1093108060 12:15113122-15113144 CAGTATATCAGGGTGAAGATGGG + Intronic
1093392368 12:18637925-18637947 CTTCATTTAATGTTGAAGCTTGG - Intronic
1093985563 12:25528644-25528666 CTGTTTCTAAGTGTGAAGCAGGG - Intronic
1094043523 12:26142608-26142630 CTGGATTTAAGTCTGAATCTTGG + Intronic
1096053260 12:48629486-48629508 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1097064214 12:56308868-56308890 CTGTATTTAATGGCAAAACTGGG - Intronic
1097239301 12:57564074-57564096 AGGTATTTGAGAGTGAAGCTGGG - Intronic
1097821723 12:64134689-64134711 CTGCATTTAATGTTGCAGCTCGG - Intronic
1097999638 12:65926147-65926169 CTGTATTTATTAGGGAAGCTCGG + Intronic
1098029743 12:66241508-66241530 TTCTATTTAAGGTTGAAGCAGGG + Intronic
1098730782 12:74035188-74035210 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1098749559 12:74277310-74277332 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1099038158 12:77615991-77616013 ATGAATTTTATGGTGAAGCTTGG - Intergenic
1099375362 12:81891792-81891814 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1099379946 12:81940926-81940948 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1099577808 12:84403262-84403284 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1099951778 12:89311880-89311902 CTGTATTTAAGGGCTGGGCTTGG - Intergenic
1100083038 12:90876049-90876071 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1102754552 12:115326908-115326930 ATGTAATTAAGGGTGAGGCCAGG + Intergenic
1103396226 12:120609268-120609290 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1104792268 12:131491100-131491122 TTGTATTTAATGGGGAAGATAGG - Intergenic
1105931752 13:25059151-25059173 CTGTGTTTAAGGGAGAAGGATGG + Intergenic
1106324223 13:28672596-28672618 CTGTTTTTAAAAGTGAAGATTGG + Intronic
1109582777 13:64363956-64363978 CTGTATTTAATGTTGCAGCTTGG + Intergenic
1111576030 13:90154948-90154970 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1113001885 13:105648627-105648649 CTGTATATATGGGTGAAATTAGG + Intergenic
1116200879 14:41793662-41793684 CTGTATATAATAGTGATGCTTGG - Intronic
1118950850 14:70435266-70435288 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1119210470 14:72827778-72827800 CTGTATTTAAGAGTAAAGGGGGG - Intronic
1120973369 14:90228278-90228300 CTGCATTTAATGCTGCAGCTTGG + Intergenic
1121371084 14:93359109-93359131 CTGCATTTAATGTTGTAGCTTGG + Intronic
1124101409 15:26697597-26697619 CAGCATTTAAGGGTGAATGTGGG - Intronic
1124450266 15:29782283-29782305 CTGTAGTTTAGTTTGAAGCTGGG - Intronic
1125790282 15:42360243-42360265 CTGTCTTTAAGTGTGAAGCAGGG + Intronic
1128668731 15:69558420-69558442 CTGTTTTTAAGGGTCAAGGAAGG - Intergenic
1133162775 16:3922888-3922910 CTGTAATTGAGGGTGAGGCAGGG + Intergenic
1135479590 16:22811935-22811957 CTGGAATAAAGGGTAAAGCTGGG + Intergenic
1136537858 16:30910778-30910800 CTGTGCCTAAGGGTGAACCTGGG - Intergenic
1138155558 16:54700012-54700034 CTATATTTGAGGGTGAGGATAGG + Intergenic
1140163954 16:72529562-72529584 CTGTTTTTCTGGGTGAAGTTTGG - Intergenic
1140628323 16:76821571-76821593 CTGTATTCAAGTGGGAAGCACGG + Intergenic
1141868071 16:86764501-86764523 CTGTATCTGAGGGTGCATCTAGG + Intergenic
1142371749 16:89686510-89686532 CCTTATTTTAGGGTGAAGCCCGG - Exonic
1146205684 17:30903691-30903713 CTGTGTCTAAGGGTGATGTTAGG - Intronic
1146850638 17:36218842-36218864 CTGCATTTAATGTTGCAGCTTGG + Intronic
1148941130 17:51212469-51212491 CTGTATTTGAGGGAGAAAATGGG + Intronic
1153131551 18:1859872-1859894 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1156303584 18:35856553-35856575 CTGCATTTAACGTTGCAGCTCGG + Intergenic
1156452222 18:37273363-37273385 CTGTATTTAAAAGTAATGCTAGG + Intronic
1156516503 18:37684853-37684875 CAGCATTTAAGGATGATGCTGGG - Intergenic
1157319985 18:46626775-46626797 TTGTCTATAAGGATGAAGCTAGG - Intronic
1158355164 18:56610290-56610312 GTATATTTAAGAGTGACGCTAGG + Intronic
1163662202 19:18585215-18585237 CTGTATATAAGGGGGAAATTAGG - Intronic
1164097410 19:22023848-22023870 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1164117593 19:22237297-22237319 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1166267468 19:41694229-41694251 CAGAAGTGAAGGGTGAAGCTGGG + Intronic
927418408 2:22903669-22903691 CTGTACTTAAGTGAGAACCTGGG - Intergenic
928197154 2:29224137-29224159 GTGGATTTGAGGGTGCAGCTGGG + Intronic
931122771 2:59238756-59238778 CTGTATTCAAGAGCGAAGCTTGG - Intergenic
933265986 2:80180905-80180927 CTGCATTTAATGTTGCAGCTTGG - Intronic
936345048 2:111669191-111669213 CTGTAATCAAGTGTGCAGCTTGG - Intergenic
936508862 2:113129785-113129807 TTGTATTCAAGTTTGAAGCTGGG + Intronic
936623974 2:114128291-114128313 CTGGATTTAAGGTTGAGGCTTGG + Intergenic
937852841 2:126650902-126650924 CTGCATTTAATGTTGCAGCTTGG - Intergenic
938254921 2:129849872-129849894 CTTGAAGTAAGGGTGAAGCTTGG - Intergenic
938585823 2:132689507-132689529 CTGTAGTTGAGTGTGAGGCTTGG + Intronic
939050800 2:137305351-137305373 CTGCATTTGATGGTGAAACTTGG + Intronic
939254161 2:139721098-139721120 CTGTTTTGAAGAGGGAAGCTTGG - Intergenic
939398058 2:141657977-141657999 CTGTATTTAAGGCAGTTGCTAGG - Intronic
939805966 2:146776287-146776309 CTGCATTTAATGTTGTAGCTCGG + Intergenic
939871516 2:147531465-147531487 CTGTTTTTATGGATGAAGTTTGG + Intergenic
940185942 2:150985053-150985075 CTGCTGTTAAGGGTGATGCTGGG + Intergenic
940278863 2:151968638-151968660 CATTATTTTAGGGTGAAGGTGGG - Intronic
940639311 2:156330780-156330802 CTGTATTTCAGGGAGGAGATTGG - Exonic
941667718 2:168258994-168259016 CTGCATTTAATGTTGCAGCTTGG + Intergenic
942462649 2:176178772-176178794 CGGTATTTAAGGGTGACACTCGG - Intergenic
942641852 2:178068972-178068994 CTTAATTTAAGGGTGGAGCATGG + Intronic
943392187 2:187283988-187284010 CTGCATTTAATGTTGCAGCTTGG - Intergenic
945544601 2:211135987-211136009 CTGCATTTAATGTTGCAGCTGGG + Intergenic
947108778 2:226696369-226696391 CAGTAGTTGAGGGTCAAGCTGGG - Intergenic
948361358 2:237422784-237422806 CTGTATTTATGGGTGGGACTTGG - Intronic
1172527226 20:35607252-35607274 CTTTCTTTAAGGGTGAATCCAGG - Intergenic
1177363445 21:20103667-20103689 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1177712837 21:24802631-24802653 CGGTCTCTAAGGGTTAAGCTTGG + Intergenic
1178061026 21:28853334-28853356 CTGCATTTAATGTTGTAGCTTGG - Intergenic
1178755185 21:35342742-35342764 CTGCATTTCAAGGGGAAGCTTGG - Intronic
1178764110 21:35433119-35433141 CTGCATTTAATGCTGCAGCTCGG - Intronic
1180301479 22:11039911-11039933 TTTTCTTTAAGGGTGAAGGTTGG - Intergenic
1181268296 22:21643591-21643613 CTGAATTTTAGGCTGAAGGTAGG + Intronic
1182890435 22:33813801-33813823 AGGTATTTAAGGCTGAAGTTGGG - Intronic
1182891337 22:33821193-33821215 CAGCATTTGTGGGTGAAGCTGGG - Intronic
1182951743 22:34382418-34382440 CTGTTTCTAAGGCTGAAACTAGG - Intergenic
1182965653 22:34518991-34519013 CTGCATTTAATGTTGCAGCTCGG - Intergenic
949245586 3:1922726-1922748 CTGCATTTAATGTTGCAGCTTGG + Intergenic
949638495 3:6010333-6010355 CTGCATTTAATGTTGCAGCTTGG + Intergenic
950782839 3:15407313-15407335 GAATATTTAAAGGTGAAGCTGGG - Intronic
951978432 3:28540367-28540389 CTGCATTTAATGTTGCAGCTTGG + Intergenic
952316245 3:32235191-32235213 CTGCACTTAAGAATGAAGCTTGG + Intergenic
954053831 3:48005511-48005533 CTGCATTTAATGTTGCAGCTCGG + Intronic
954800637 3:53185174-53185196 CTTTACTTGAGGGTGAACCTGGG + Intronic
957897841 3:86446642-86446664 CTGCATTTAATGTTGCAGCTTGG + Intergenic
958687081 3:97412338-97412360 CTGAATTTAAAGGTGTAACTTGG - Intronic
958845814 3:99262736-99262758 CTGCATTTAATGTTGCAGCTTGG - Intergenic
959216175 3:103453040-103453062 ATGTATTTAAGTATGTAGCTTGG - Intergenic
959746297 3:109779439-109779461 CTGCATTTAATGTTGCAGCTCGG - Intergenic
960127251 3:114013886-114013908 CTGTTTTTGAGGATGAATCTGGG - Intronic
960169352 3:114440325-114440347 CTGTAAGGAAGGGTGGAGCTGGG + Intronic
963630023 3:147721038-147721060 CTGCATTTAATGTTGCAGCTTGG + Intergenic
963661105 3:148129949-148129971 CTGCATTTAATGTTGTAGCTTGG + Intergenic
964756165 3:160092385-160092407 ATGGAATTGAGGGTGAAGCTAGG - Intergenic
967047356 3:185750081-185750103 CAGTATTTCTGGGTGAATCTGGG + Intronic
967463871 3:189779688-189779710 CTATACTTAAGGCTGGAGCTTGG - Intronic
970629242 4:17923273-17923295 CTGCATTTAATGTTGCAGCTTGG + Intronic
971231729 4:24805583-24805605 CAGTTCTTAAGGGTGAATCTTGG + Intergenic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
977702025 4:100032075-100032097 CTGCATTTAATGTTGCAGCTTGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978461136 4:108953573-108953595 CTGAATAGAAGAGTGAAGCTGGG + Intronic
980388193 4:132113295-132113317 CTGCATTTAATGTTGCAGCTTGG - Intergenic
980957489 4:139444186-139444208 CTGCATTTAATGTTGCAGCTCGG + Intergenic
981045102 4:140257474-140257496 CAGTATTTAAGGGGGAGGTTTGG + Intronic
986938603 5:12920926-12920948 CTGAATTTAATGTTGCAGCTTGG - Intergenic
986955816 5:13148324-13148346 CTGCATTTAATGTTGCAGCTCGG - Intergenic
987504123 5:18747671-18747693 CTGCATTTAATGTTGCAGCTTGG + Intergenic
987999773 5:25332813-25332835 CTTTATTTAGGGGTGAATTTTGG - Intergenic
988161094 5:27519065-27519087 CTGCATTTAATGTTGCAGCTTGG - Intergenic
989097491 5:37794813-37794835 CTGCATTTAATGTTGCAGCTTGG + Intergenic
989239678 5:39189535-39189557 CTGTGTTGAAGGGTTCAGCTTGG + Intronic
990120939 5:52450611-52450633 GTGTATTTTAGGGGGAAGGTGGG - Intergenic
992641359 5:78770980-78771002 CAATATTTAAAGGGGAAGCTGGG + Intergenic
993031701 5:82713840-82713862 GAGGATTTTAGGGTGAAGCTGGG - Intergenic
994060163 5:95466713-95466735 CTGTATTTAAGCAAGAAGCAAGG - Intronic
994207389 5:97050640-97050662 CTGTATTTAAGGAGGAAGCTGGG + Intergenic
995766759 5:115627239-115627261 CTAGATTTAAGGAAGAAGCTGGG - Intronic
996096364 5:119403195-119403217 CTGTAGTTTAGTGTGAAGCACGG - Intergenic
996243724 5:121233936-121233958 CTGTATTAAAGGGTGAGTCAGGG + Intergenic
996687565 5:126300804-126300826 CTGTGTTTCAGGCTGAAGCACGG + Intergenic
997400772 5:133599971-133599993 CTGTATTTGAGGGGGAACCAAGG - Intronic
998290615 5:140910769-140910791 CTGCATTTAATGTTGCAGCTTGG - Intronic
1000416684 5:160991754-160991776 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1006001214 6:30966585-30966607 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1010581004 6:77595931-77595953 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1010818310 6:80385916-80385938 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1011008214 6:82672842-82672864 CTGTATTAAAGGGAGAGACTAGG - Intergenic
1012344296 6:98168132-98168154 CTGTATTTAATGTTGCAGCTTGG + Intergenic
1015467214 6:133560423-133560445 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1015475449 6:133655129-133655151 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1016120189 6:140334842-140334864 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1016144004 6:140647216-140647238 CTGTATTTAATGTTGCAGCTTGG + Intergenic
1016372221 6:143386946-143386968 GCCTATTTAAGGGTGAAGGTGGG - Intergenic
1017228104 6:152043278-152043300 CTGCATTTAATGTTGCAGCTTGG - Intronic
1017721142 6:157244003-157244025 CTGTAACAAAGGGTGCAGCTTGG - Intergenic
1018055092 6:160045409-160045431 CTGCTTTTAAGTGTGTAGCTTGG + Intronic
1018107621 6:160503993-160504015 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1018123259 6:160657720-160657742 CTGCATTTAATGTTGCAGCTCGG - Intronic
1018569680 6:165195891-165195913 CTGCATTTAATGTTGTAGCTTGG + Intergenic
1019538404 7:1540525-1540547 CTGTATTGCAGGGTGAAGAGTGG + Exonic
1021645988 7:22789886-22789908 TTGTTTTTGAGGGTGAAGGTGGG + Intergenic
1023466549 7:40462135-40462157 CAGAAGTTAAGTGTGAAGCTGGG + Intronic
1023663213 7:42492194-42492216 CTATATTTAAGAGTTAAACTTGG + Intergenic
1024604244 7:51011562-51011584 CTGTGTGTAAGGGTGGGGCTTGG + Intergenic
1024958543 7:54951268-54951290 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1028141460 7:87279786-87279808 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1028147898 7:87339231-87339253 TTGTATTTTATGGTGAAGCAAGG - Intergenic
1029849068 7:103444005-103444027 TTGTTTTCAAGGGTGAAGGTGGG + Intronic
1031539801 7:122980508-122980530 CTGTAGTTAATGGTGAAGTAAGG - Intergenic
1032763733 7:134970725-134970747 CTGTATTTCAGGTTGAGTCTTGG + Intronic
1033075928 7:138250513-138250535 CTGCATTTAATGTTGCAGCTCGG + Intergenic
1034046742 7:147937317-147937339 ATGTATTTAGGTGGGAAGCTGGG - Intronic
1036177352 8:6551278-6551300 CGGTATTTAGGGGTGAAGAAGGG + Intronic
1038628038 8:29213422-29213444 CTGTATTTAATTGTGGACCTTGG - Intronic
1041985902 8:63922289-63922311 CTGCATTTAATGCTGCAGCTTGG + Intergenic
1042736353 8:71993629-71993651 CTTTATTTCAGGGAGAAGCAAGG + Intronic
1044150523 8:88770903-88770925 CTGCATTTAATGTTGCAGCTGGG + Intergenic
1047263818 8:123286765-123286787 CTGTATTTTAGGCTGAAGCGTGG + Intergenic
1049353773 8:142177762-142177784 TTGTAATTAAGGGTGCAGCGAGG - Intergenic
1050447335 9:5739323-5739345 CTGCATTTAAAGCTGCAGCTCGG - Intronic
1055584525 9:77744142-77744164 CTGTAGTGAAGGATGAAGTTTGG + Intronic
1056115386 9:83436106-83436128 CTGGAGTTAAGAGTGAAGGTAGG - Intronic
1057316636 9:93973237-93973259 CTGCATTTAATGTTGCAGCTTGG + Intergenic
1059671929 9:116500101-116500123 CTGTAGCAAAGGGTGAGGCTGGG - Intronic
1059912594 9:119062416-119062438 GTCTACTTAAGGGTGAAGGTTGG - Intergenic
1059938770 9:119337586-119337608 ATGTAGTTAAGGGAGAATCTTGG - Intronic
1060319366 9:122541641-122541663 CTGTATTTAAGGTGGAGGCTTGG - Intergenic
1060805670 9:126574584-126574606 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1187724760 X:22190896-22190918 CTGTATGTAAGAAAGAAGCTTGG + Intronic
1189570217 X:42286893-42286915 ATGTTTTTAAGGTTGAAACTTGG + Intergenic
1190312631 X:49127860-49127882 ATGTATTTAAAGGTGAGGCACGG + Intergenic
1191114066 X:56833210-56833232 CTGTATTGAATGTTGCAGCTTGG - Intergenic
1191719528 X:64217850-64217872 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1191735339 X:64382998-64383020 CTGTATTTAAGGGTGAAGCTTGG - Intronic
1191769777 X:64742290-64742312 CTGCATTTAATGTTGCAGCTCGG - Intergenic
1193454571 X:81714405-81714427 TTGTATTTATGGGATAAGCTTGG + Intergenic
1193875807 X:86861503-86861525 CTGGATTTAATGTTGTAGCTAGG + Intergenic
1195094360 X:101490910-101490932 CTGTGTCTAAGGCAGAAGCTGGG + Exonic
1195749134 X:108146869-108146891 CTGCATTTAATGTTGCAGCTCGG - Intronic
1196372613 X:114996295-114996317 CTGCATTTAATGTTGCAGCTCGG - Intergenic
1197074330 X:122337092-122337114 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1197497747 X:127207165-127207187 CTGCATTTAATGTTGCAGCTTGG - Intergenic
1198404892 X:136302523-136302545 CTGCATTTAATGTTGCAGCTGGG - Intronic
1198933684 X:141885342-141885364 CTGCATTTAATGTTGCAGCTTGG + Intronic
1199587584 X:149432391-149432413 TTGTGGTTAAGGGTGGAGCTGGG - Intergenic
1200340578 X:155391279-155391301 CTGCATTTAATGTTGCAGCTCGG - Intergenic