ID: 1191742539

View in Genome Browser
Species Human (GRCh38)
Location X:64451301-64451323
Sequence AACAGCTATTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191742539_1191742544 11 Left 1191742539 X:64451301-64451323 CCAGTAACAGGCCAATAGCTGTT No data
Right 1191742544 X:64451335-64451357 GGGTAGTTATCTGCAGAAGATGG No data
1191742539_1191742545 16 Left 1191742539 X:64451301-64451323 CCAGTAACAGGCCAATAGCTGTT No data
Right 1191742545 X:64451340-64451362 GTTATCTGCAGAAGATGGCAAGG 0: 180
1: 172
2: 120
3: 86
4: 284
1191742539_1191742546 22 Left 1191742539 X:64451301-64451323 CCAGTAACAGGCCAATAGCTGTT No data
Right 1191742546 X:64451346-64451368 TGCAGAAGATGGCAAGGCCTTGG No data
1191742539_1191742543 -9 Left 1191742539 X:64451301-64451323 CCAGTAACAGGCCAATAGCTGTT No data
Right 1191742543 X:64451315-64451337 ATAGCTGTTTCTCAAAAGGAGGG No data
1191742539_1191742542 -10 Left 1191742539 X:64451301-64451323 CCAGTAACAGGCCAATAGCTGTT No data
Right 1191742542 X:64451314-64451336 AATAGCTGTTTCTCAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191742539 Original CRISPR AACAGCTATTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr