ID: 1191750478

View in Genome Browser
Species Human (GRCh38)
Location X:64536772-64536794
Sequence CAAAAGAGCCTATAACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191750476_1191750478 -7 Left 1191750476 X:64536756-64536778 CCTTTGGGTGGACTTCCAAAAGA No data
Right 1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG No data
1191750471_1191750478 28 Left 1191750471 X:64536721-64536743 CCTCTGATCTACTGGCTGAGCTA No data
Right 1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG No data
1191750470_1191750478 29 Left 1191750470 X:64536720-64536742 CCCTCTGATCTACTGGCTGAGCT No data
Right 1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191750478 Original CRISPR CAAAAGAGCCTATAACCCCA TGG Intergenic
No off target data available for this crispr