ID: 1191755159

View in Genome Browser
Species Human (GRCh38)
Location X:64584914-64584936
Sequence GTGTTCTTACATGAAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191755159_1191755168 22 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755168 X:64584959-64584981 ATAAAAGAGGCAATCCTTGGGGG No data
1191755159_1191755166 20 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755166 X:64584957-64584979 TAATAAAAGAGGCAATCCTTGGG No data
1191755159_1191755167 21 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755167 X:64584958-64584980 AATAAAAGAGGCAATCCTTGGGG No data
1191755159_1191755165 19 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755165 X:64584956-64584978 TTAATAAAAGAGGCAATCCTTGG No data
1191755159_1191755163 -7 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755163 X:64584930-64584952 AGAACACTGGAGGGATATAACGG No data
1191755159_1191755164 9 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755164 X:64584946-64584968 ATAACGGACATTAATAAAAGAGG No data
1191755159_1191755169 30 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755169 X:64584967-64584989 GGCAATCCTTGGGGGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191755159 Original CRISPR GTGTTCTTACATGAAAACAC AGG (reversed) Intergenic
No off target data available for this crispr