ID: 1191755163

View in Genome Browser
Species Human (GRCh38)
Location X:64584930-64584952
Sequence AGAACACTGGAGGGATATAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191755159_1191755163 -7 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755163 X:64584930-64584952 AGAACACTGGAGGGATATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191755163 Original CRISPR AGAACACTGGAGGGATATAA CGG Intergenic
No off target data available for this crispr