ID: 1191755169

View in Genome Browser
Species Human (GRCh38)
Location X:64584967-64584989
Sequence GGCAATCCTTGGGGGCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191755159_1191755169 30 Left 1191755159 X:64584914-64584936 CCTGTGTTTTCATGTAAGAACAC No data
Right 1191755169 X:64584967-64584989 GGCAATCCTTGGGGGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191755169 Original CRISPR GGCAATCCTTGGGGGCTTCA AGG Intergenic
No off target data available for this crispr