ID: 1191759361

View in Genome Browser
Species Human (GRCh38)
Location X:64629931-64629953
Sequence GACAGCTCTCAGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191759357_1191759361 16 Left 1191759357 X:64629892-64629914 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1191759361 X:64629931-64629953 GACAGCTCTCAGCCTGTTACTGG No data
1191759359_1191759361 11 Left 1191759359 X:64629897-64629919 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1191759361 X:64629931-64629953 GACAGCTCTCAGCCTGTTACTGG No data
1191759358_1191759361 15 Left 1191759358 X:64629893-64629915 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1191759361 X:64629931-64629953 GACAGCTCTCAGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191759361 Original CRISPR GACAGCTCTCAGCCTGTTAC TGG Intergenic
No off target data available for this crispr