ID: 1191760803

View in Genome Browser
Species Human (GRCh38)
Location X:64646427-64646449
Sequence CAATAATTCAACAAGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191760803_1191760808 16 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760808 X:64646466-64646488 TAATATGGGCAATGGATTCCAGG No data
1191760803_1191760805 1 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760805 X:64646451-64646473 CCAAAATGTTGATAGTAATATGG No data
1191760803_1191760807 8 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760807 X:64646458-64646480 GTTGATAGTAATATGGGCAATGG No data
1191760803_1191760806 2 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG No data
1191760803_1191760809 25 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760809 X:64646475-64646497 CAATGGATTCCAGGAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191760803 Original CRISPR CAATAATTCAACAAGTATCT AGG (reversed) Intergenic
No off target data available for this crispr