ID: 1191760806

View in Genome Browser
Species Human (GRCh38)
Location X:64646452-64646474
Sequence CAAAATGTTGATAGTAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191760803_1191760806 2 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191760806 Original CRISPR CAAAATGTTGATAGTAATAT GGG Intergenic
No off target data available for this crispr