ID: 1191760809

View in Genome Browser
Species Human (GRCh38)
Location X:64646475-64646497
Sequence CAATGGATTCCAGGAAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191760803_1191760809 25 Left 1191760803 X:64646427-64646449 CCTAGATACTTGTTGAATTATTG No data
Right 1191760809 X:64646475-64646497 CAATGGATTCCAGGAAGAAGTGG No data
1191760804_1191760809 1 Left 1191760804 X:64646451-64646473 CCAAAATGTTGATAGTAATATGG No data
Right 1191760809 X:64646475-64646497 CAATGGATTCCAGGAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191760809 Original CRISPR CAATGGATTCCAGGAAGAAG TGG Intergenic
No off target data available for this crispr