ID: 1191769275

View in Genome Browser
Species Human (GRCh38)
Location X:64738410-64738432
Sequence AAGGGAATTACAGTGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769275_1191769278 2 Left 1191769275 X:64738410-64738432 CCAGCAAACACTGTAATTCCCTT No data
Right 1191769278 X:64738435-64738457 TAGCCTTTTGATTTAAAAGTAGG No data
1191769275_1191769282 25 Left 1191769275 X:64738410-64738432 CCAGCAAACACTGTAATTCCCTT No data
Right 1191769282 X:64738458-64738480 AGGAGCCCAAAGTGTCCAGGTGG 0: 136
1: 236
2: 158
3: 170
4: 339
1191769275_1191769281 22 Left 1191769275 X:64738410-64738432 CCAGCAAACACTGTAATTCCCTT No data
Right 1191769281 X:64738455-64738477 AGGAGGAGCCCAAAGTGTCCAGG 0: 114
1: 227
2: 161
3: 144
4: 340
1191769275_1191769280 5 Left 1191769275 X:64738410-64738432 CCAGCAAACACTGTAATTCCCTT No data
Right 1191769280 X:64738438-64738460 CCTTTTGATTTAAAAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769275 Original CRISPR AAGGGAATTACAGTGTTTGC TGG (reversed) Intergenic
No off target data available for this crispr