ID: 1191769278

View in Genome Browser
Species Human (GRCh38)
Location X:64738435-64738457
Sequence TAGCCTTTTGATTTAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769275_1191769278 2 Left 1191769275 X:64738410-64738432 CCAGCAAACACTGTAATTCCCTT No data
Right 1191769278 X:64738435-64738457 TAGCCTTTTGATTTAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769278 Original CRISPR TAGCCTTTTGATTTAAAAGT AGG Intergenic
No off target data available for this crispr