ID: 1191769282

View in Genome Browser
Species Human (GRCh38)
Location X:64738458-64738480
Sequence AGGAGCCCAAAGTGTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1039
Summary {0: 136, 1: 236, 2: 158, 3: 170, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769275_1191769282 25 Left 1191769275 X:64738410-64738432 CCAGCAAACACTGTAATTCCCTT No data
Right 1191769282 X:64738458-64738480 AGGAGCCCAAAGTGTCCAGGTGG 0: 136
1: 236
2: 158
3: 170
4: 339
1191769277_1191769282 6 Left 1191769277 X:64738429-64738451 CCTTCTTAGCCTTTTGATTTAAA No data
Right 1191769282 X:64738458-64738480 AGGAGCCCAAAGTGTCCAGGTGG 0: 136
1: 236
2: 158
3: 170
4: 339
1191769279_1191769282 -3 Left 1191769279 X:64738438-64738460 CCTTTTGATTTAAAAGTAGGAGG No data
Right 1191769282 X:64738458-64738480 AGGAGCCCAAAGTGTCCAGGTGG 0: 136
1: 236
2: 158
3: 170
4: 339
1191769276_1191769282 7 Left 1191769276 X:64738428-64738450 CCCTTCTTAGCCTTTTGATTTAA No data
Right 1191769282 X:64738458-64738480 AGGAGCCCAAAGTGTCCAGGTGG 0: 136
1: 236
2: 158
3: 170
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769282 Original CRISPR AGGAGCCCAAAGTGTCCAGG TGG Intergenic
900992976 1:6106494-6106516 AGGAGCCGAAAGCGCCCTGGAGG + Exonic
901445036 1:9303029-9303051 GGGAGCCCAAAGAAGCCAGGTGG - Intronic
901877262 1:12173986-12174008 GTGAGCCCCAAGTGTGCAGGGGG + Intronic
901903692 1:12390020-12390042 CGGAGCCCAAAGTGTCCAGGTGG + Intronic
901972322 1:12917983-12918005 AGGTGACCCAGGTGTCCAGGTGG + Intronic
902012857 1:13283779-13283801 AGGTGACCCAGGTGTCCAGGTGG - Intronic
903212194 1:21824500-21824522 AGGAGCCCCAAGAGCCCAGCCGG + Exonic
904442980 1:30543814-30543836 GGGAGCCCCACGTGGCCAGGTGG - Intergenic
904675578 1:32197346-32197368 AGGAGGCCACAGTGAGCAGGTGG + Exonic
905465465 1:38149772-38149794 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
906050715 1:42869075-42869097 AGGAACCCAAAGTGTCCAGGTGG - Intergenic
906188754 1:43881848-43881870 GGGAGATCAAAGTGTCCATGAGG + Intronic
906448326 1:45922480-45922502 AGGGGGCCAAAGTGGCAAGGGGG + Intronic
906879886 1:49578121-49578143 AGGAGACTAAAGTATCCAGGTGG - Intronic
907249081 1:53126026-53126048 AGTTGCCCATAGAGTCCAGGAGG + Intronic
907597578 1:55733784-55733806 AGAAGCCCAAAGTATCCTGGTGG - Intergenic
907601918 1:55780622-55780644 AGGAGTCCAAAGTGGCCAGGTGG + Intergenic
907955890 1:59227921-59227943 AGGCGCCCAAAGTGACCATAAGG + Intergenic
908052548 1:60248367-60248389 AAGAGCCCAAATTGTCCAGGTGG - Intergenic
908117356 1:60953226-60953248 ATGAGGACAAAGGGTCCAGGAGG + Intronic
908596587 1:65694693-65694715 AGGAGCCCCAAGTGGCCAGGTGG - Intergenic
908737628 1:67292471-67292493 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
909032652 1:70560628-70560650 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
909172380 1:72313802-72313824 AGGAGCCCTAAATGTCCAGGTGG + Intergenic
909215158 1:72877580-72877602 AGGAGCCCAAAGTGGCCAGTTGG - Intergenic
909475170 1:76074364-76074386 ATGTGCCCAAAGTCTCCAGAAGG + Intergenic
909548720 1:76875518-76875540 AGGAACCCAAGGTGTCCAGGTGG + Intronic
909577155 1:77187499-77187521 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
909811168 1:79932996-79933018 AGGACCCCAAAGTGTACAGGTGG - Intergenic
909858693 1:80575374-80575396 AGGAGCCCAAAGTGGCCAGGGGG + Intergenic
910087223 1:83417982-83418004 AGTAGCCCAAAGTGTGGAGTAGG + Intergenic
910141737 1:84033709-84033731 AGGAGTCCAAAATATCCAGGTGG - Intergenic
910318188 1:85913581-85913603 AGAAGCCCAAAGTGGCCGGATGG - Intronic
910370871 1:86513814-86513836 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
910562122 1:88601619-88601641 TAGAGTACAAAGTGTCCAGGTGG - Intergenic
910588450 1:88903388-88903410 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
910790521 1:91045103-91045125 AGGAGCCCAGAGTGTCCAGGTGG - Intergenic
910791584 1:91056477-91056499 AGGAGCCCAAAGTTGCCAGGTGG + Intergenic
910830864 1:91461755-91461777 AGGATCCCAAAGTGTCCAGGTGG + Intergenic
910948444 1:92618375-92618397 AACAGCCCGAAGTGTCCAGGTGG - Intronic
911108935 1:94163039-94163061 AGGAGCCCAAAGTGTCCAGTTGG + Intronic
911257109 1:95645695-95645717 AGGAGCCCAAAGGGCCCAGGTGG + Intergenic
911403589 1:97407905-97407927 GGTAGCCCAAAATGGCCAGGTGG - Intronic
911738177 1:101360268-101360290 AGGGTCCCAAAGTGTCCAGGTGG + Intergenic
911791622 1:102023366-102023388 AGGAGCCCAAATTGTTTAAGTGG - Intergenic
911831743 1:102557962-102557984 GGGAGCCCAAAGTGTCCAGGTGG + Intergenic
911980637 1:104561081-104561103 AGGAGCCCAAAGTGCTCAGGTGG - Intergenic
912050476 1:105523275-105523297 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
912067232 1:105758619-105758641 GGGAGCACAAAGTGTCCAGGTGG - Intergenic
912129690 1:106586392-106586414 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
912251805 1:108019814-108019836 AGGACCCCAAAGTGTCCGGGTGG + Intergenic
912368540 1:109154702-109154724 AGAAGCACAAGGTGACCAGGTGG - Intronic
912733090 1:112127169-112127191 AGGAGCCCAAAGTCTTCAGGTGG + Intergenic
912943522 1:114066227-114066249 AGGAGTCCAAAGTGTTCAGGTGG + Intergenic
913039221 1:115006727-115006749 AAGAGCCCAAAGTGTTTAGGTGG + Intergenic
913081377 1:115390466-115390488 AAAAGCCCAAAGTGGCCAGGTGG - Intergenic
913559389 1:120002238-120002260 AGGAACCCAAAGTGTCCTGGTGG - Intronic
913638472 1:120788304-120788326 AGGAACCCAAAGTGTCCTGGTGG + Intergenic
914279984 1:146161681-146161703 AGGAACCCAAAGTGTCCTGGTGG - Intronic
914541024 1:148612599-148612621 AGGAACCCAAAGTGTCCTGGTGG - Intronic
914625618 1:149458647-149458669 AGGAACCCAAAGTGTCCTGGTGG + Intergenic
915474747 1:156147026-156147048 AGGAGCCCAAGGGGAACAGGGGG + Intergenic
915667443 1:157458029-157458051 AGGAGCCTAAAGTGTCCAGGTGG + Intergenic
915709881 1:157885305-157885327 AGAAGCCCCAAATGTCCAGGTGG - Intronic
916017115 1:160759975-160759997 AGGAGGCCAAAGTACTCAGGTGG + Intergenic
916105960 1:161432631-161432653 AGGAGCCCAAAGTGTCTAGGTGG + Intergenic
916108045 1:161444831-161444853 AGGAGTCCAGGGTGTCCAGGGGG - Intergenic
916109631 1:161452211-161452233 AGGAGTCCAGGGTGTCCAGGGGG - Intergenic
916111216 1:161459620-161459642 AGGAGTCCAGGGTGTCCAGGGGG - Intergenic
916112804 1:161467002-161467024 AGGAGTCCAGGGTGTCCAGGGGG - Intergenic
916115516 1:161482002-161482024 AAGAGTCCAGAGTGTCCAGGGGG - Intergenic
916285555 1:163101179-163101201 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
916370038 1:164081758-164081780 AGAAGCCCAAAGTTTTCAGATGG - Intergenic
916639461 1:166711481-166711503 AGGAGTCCAAAATGGTCAGGTGG + Intergenic
917052295 1:170938164-170938186 AGGAGACCAAGGTGGCCAGGTGG + Intronic
917216989 1:172689240-172689262 AGGAGCCTAAAGTGTCCAGGTGG + Intergenic
917283423 1:173400567-173400589 AAGAGCCCAAAGTGGCCAGGTGG - Intergenic
917462935 1:175247821-175247843 AGGAGCCCAAAGTGTCCAGTTGG - Intergenic
917764763 1:178203675-178203697 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
918755490 1:188336152-188336174 AGGAGACCAAACTGTCCAGGTGG + Intergenic
918774727 1:188612403-188612425 AGGAGCCCAAAGTGTCCAGATGG - Intergenic
918783240 1:188730884-188730906 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
918815271 1:189172860-189172882 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
918918013 1:190670218-190670240 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
919124152 1:193376324-193376346 AGGAGACAAAAGTGGCCAGGTGG + Intergenic
919230007 1:194762330-194762352 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
919318196 1:196001012-196001034 AGGATCCCAAAGTGACTAGGTGG - Intergenic
919330430 1:196163532-196163554 AGGAGCCTAAAGTGTCCAGGTGG - Intergenic
919478861 1:198062029-198062051 AGGAACCCAAAGTGGCCAGGTGG + Intergenic
919701346 1:200634466-200634488 AGGAGCTCAGAGAGGCCAGGAGG + Intronic
920197665 1:204240022-204240044 AGGAATCTAAAGTGTCCAGGTGG - Intronic
921823849 1:219649260-219649282 AGGAGCTCACAGTCTACAGGGGG - Intergenic
922020195 1:221696624-221696646 AGGAGCCCAAAGTCGGCAGCAGG - Intergenic
922050581 1:221986434-221986456 AGGATCCTAAAGTGGCCACGTGG + Intergenic
922339119 1:224641371-224641393 GGGAATCCAAAGAGTCCAGGTGG - Intronic
922780825 1:228250940-228250962 AGGAGCCCAAAGTGGCCAGGTGG + Intronic
922956330 1:229604433-229604455 AGGAGCCCAAAGTGGCTGGGTGG - Intronic
923253352 1:232197782-232197804 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
923957469 1:239039322-239039344 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
924492162 1:244548959-244548981 AGGAGCCCAAAGTGGTGAGGTGG - Intronic
924829699 1:247580001-247580023 AAGAGCTCAAAGTGGCCAGGTGG - Intergenic
924840544 1:247706163-247706185 AGGAGCCCAAAGTGTCCAAGTGG + Intergenic
924846910 1:247783480-247783502 AGGAGAACAAAGTGTCCAGGGGG + Intergenic
1062857471 10:786527-786549 AAGACCCCAAAGTATGCAGGGGG + Intergenic
1063984860 10:11491532-11491554 AGGAGCCCAAAGTGGTTGGGTGG - Intronic
1064445806 10:15391819-15391841 AGAAACCCAAAGTGACCTGGTGG + Intergenic
1064517356 10:16166117-16166139 AGGAGCCCAAAGTGTCCAGGAGG + Intergenic
1064784454 10:18878386-18878408 AGGATCCCAAGGGGTCCAGGTGG - Intergenic
1065312740 10:24431835-24431857 AGGATCCCAGAGTTCCCAGGGGG - Intronic
1065607202 10:27430125-27430147 AGGAGTCTAAAGTGGCCAAGTGG - Intergenic
1065661376 10:28007211-28007233 AGGAGCCCAATGTAGCCAGGTGG - Intergenic
1066169771 10:32828979-32829001 AGGAGCCCAAAGTGTCCATGTGG - Intronic
1066433543 10:35375427-35375449 ATGAGCCCAGATTTTCCAGGTGG - Intronic
1066629991 10:37449865-37449887 AGGAGCCCGAAGTGACCAGGAGG - Intergenic
1066957847 10:42189712-42189734 AGGACCCCAAAGCGTCCAAGTGG - Intergenic
1067125323 10:43510884-43510906 AGAAGCCCAAAGTGTTCAGGTGG + Intergenic
1067516659 10:46952902-46952924 AGGAACCCAAAATGTCCTGGTGG + Intronic
1067645591 10:48098891-48098913 AGGAACCCAAAATGTCCTGGTGG - Intergenic
1068422620 10:56815978-56816000 AGGAGTCATAAGTGTTCAGGTGG - Intergenic
1068447425 10:57140252-57140274 AGGAGCCCAAAGTATCCAGGTGG - Intergenic
1068836990 10:61566713-61566735 AGCAGCCCAAAGTGTCCAGGTGG + Intergenic
1068856856 10:61806547-61806569 AGGAACCCAAAGTGGCCGGGTGG - Intergenic
1069145977 10:64892087-64892109 AGAAGCCCAAAGTGACCAGGTGG - Intergenic
1069192081 10:65504715-65504737 AAGAGCCCAAAGTGTCCACGTGG + Intergenic
1069790594 10:71017916-71017938 AGGATCCCAAACTGTCCAGGTGG + Intergenic
1071032973 10:81206436-81206458 AGAATCCCAAAGTGGCCAGGTGG - Intergenic
1071266847 10:83972337-83972359 AGGAGCCCAAAGTTTCCAGGTGG + Intergenic
1071308737 10:84323745-84323767 TGGAGCCTAAAGTGGCCAGGTGG - Intergenic
1071364248 10:84882856-84882878 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
1071760077 10:88593180-88593202 AAGAGCCCAAAGTGACCAGGCGG + Intronic
1071942552 10:90606116-90606138 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1072209030 10:93230045-93230067 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1073557588 10:104467559-104467581 AGAAGCCAAAAGTGTCCAGGTGG - Intergenic
1073684264 10:105735370-105735392 TGGTGCCCAAAGTGACCAAGTGG + Intergenic
1073830316 10:107376360-107376382 AGGAACCCAAAGTGGCCAGGTGG + Intergenic
1073918265 10:108430785-108430807 AGGAGCCCCAAGTGTCCAGGTGG + Intergenic
1073957530 10:108890512-108890534 AGGAGCCCAAAGTGGCCAAGTGG + Intergenic
1073995652 10:109313122-109313144 AGAAGACCAAAGTGTCCAGGAGG + Intergenic
1074235452 10:111580451-111580473 AGGAACCCAAAGTGGCCAGGTGG + Intergenic
1074243975 10:111669338-111669360 AGGATCCTGAAGTGTCCAGGTGG + Intergenic
1074632322 10:115272418-115272440 AGGAACCCAAAGTGGCCAAGTGG + Intronic
1075092923 10:119453510-119453532 AGGCGCCAACAGTGTCAAGGCGG - Intronic
1075466451 10:122655118-122655140 ATGCGCCCAATGTGCCCAGGGGG - Intergenic
1075607026 10:123819070-123819092 AGGAGCCCAAAGCATCTAGGTGG - Intronic
1075656465 10:124165022-124165044 ATGAACCAAAAGTGTCCTGGAGG - Intergenic
1075855061 10:125622850-125622872 AGGAGCCCAGAGTGGCCAGGTGG + Intronic
1075948862 10:126460411-126460433 GGGAGCTCAGAGTGCCCAGGCGG + Intronic
1076395359 10:130134901-130134923 AGGAGCCCCAAGTGTCTGGGTGG + Intergenic
1077268961 11:1666218-1666240 AGGAGGGCAGAGGGTCCAGGAGG - Intergenic
1077271650 11:1684643-1684665 AGGAGGGCAGAGGGTCCAGGAGG + Intergenic
1077271656 11:1684660-1684682 AGGAGGGCAGAGGGTCCAGGAGG + Intergenic
1077271698 11:1684755-1684777 AGGAGGGCAGAGGGTCCAGGAGG + Intergenic
1077347985 11:2073155-2073177 AGGAATCCAAAGGGCCCAGGTGG + Intergenic
1077382062 11:2248725-2248747 AGGAGCCCGAAGTGACCAGGTGG - Intergenic
1078195487 11:9133548-9133570 AGGAGTCCAAAGTACCCTGGTGG - Intronic
1078906368 11:15691844-15691866 AGGAGCCCAAAGTGACCTGGTGG - Intergenic
1080042030 11:27769160-27769182 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
1080046541 11:27814472-27814494 CTGAGCCCAAAATGGCCAGGTGG + Intergenic
1081065238 11:38533107-38533129 CAGATCCCAAAGTGTCCAGGTGG + Intergenic
1081110755 11:39130382-39130404 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1081378517 11:42387557-42387579 AGGAGCCCAAAGTGTCCAAGTGG - Intergenic
1081609296 11:44549528-44549550 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1082671913 11:56044669-56044691 AGGGTCCCAAAGTGTCCAGGTGG - Intergenic
1082715444 11:56606473-56606495 AAGAGCTCAAAGTGGCCAGGTGG - Intergenic
1082836048 11:57650738-57650760 AAGAGCCCAAAGTGGCCAGGTGG - Intronic
1082999877 11:59281504-59281526 AGGAGCTCAAAGTGTCCAGGTGG - Intergenic
1083093358 11:60222762-60222784 AGGAGCCCAAAATGGCCAGGTGG - Intronic
1083476685 11:62919936-62919958 GGGAGTCCAAAGTGTCAAGAAGG - Intronic
1083785589 11:64944309-64944331 GGGAGCATAAAGTGGCCAGGAGG - Intronic
1084189186 11:67491313-67491335 AGGAGCCCACAGTCTTAAGGGGG + Intergenic
1084464248 11:69313060-69313082 AGGGCCCCAAAGGGTTCAGGAGG + Intronic
1084734371 11:71094827-71094849 GGGAACCCCAAGAGTCCAGGCGG + Intronic
1085686192 11:78623829-78623851 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1085748555 11:79137207-79137229 AGGAGCTCAAAATGTCCAGGTGG - Intronic
1086141402 11:83504535-83504557 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1086151939 11:83621469-83621491 AGAAGACCAAAGTGTCCTGCAGG + Intronic
1086278832 11:85162080-85162102 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1086332318 11:85766193-85766215 AGAGGCCTAAAGTGTCAAGGGGG + Intronic
1086834347 11:91602034-91602056 GGGAGACCAAAGTGTCCAGGTGG - Intergenic
1086990000 11:93292348-93292370 AGGAGCACAAAGTGGCCAGATGG - Intergenic
1087002451 11:93434584-93434606 AGGAGCCCAAAGTGACCACATGG + Intronic
1087374240 11:97322187-97322209 AGGAACCCAAAGTGCCGAGGTGG - Intergenic
1088097426 11:106116801-106116823 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1088100998 11:106155588-106155610 GGGAGCCAAAAGTGACCACGTGG + Intergenic
1088157766 11:106829624-106829646 AGGAGCTCAAAATATCCAGGTGG - Intronic
1088191447 11:107233046-107233068 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1088265659 11:107985244-107985266 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
1088391517 11:109320016-109320038 AGGATCCCAAGGTGACCAAGTGG - Intergenic
1088407387 11:109497029-109497051 GGGAGCCCAAAATGTCTGGGTGG + Intergenic
1088449573 11:109966991-109967013 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1088693913 11:112350040-112350062 CAGAGCCCAATGTGTCCAGCTGG + Intergenic
1088836885 11:113585021-113585043 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
1089142207 11:116294596-116294618 AGAAGCCCAAAGTGGCTGGGTGG - Intergenic
1089164890 11:116468240-116468262 AGGAGCCCAAGATGATCAGGAGG - Intergenic
1089702942 11:120256401-120256423 AGCAGGACAAAGTGTCCAAGTGG + Intronic
1089903849 11:122015253-122015275 AGGAGCCCAGAGTGTCCAGGTGG - Intergenic
1090171883 11:124612705-124612727 AGGAGCACAAAAAGCCCAGGGGG + Intronic
1090197040 11:124825683-124825705 AGAAGCCCAAAGTGGCCAGGTGG + Intergenic
1090209258 11:124906415-124906437 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
1090314315 11:125771507-125771529 GGGAGCTCAAATTGTCCAGGAGG + Intergenic
1090753796 11:129770952-129770974 AGGACCCCAAAGTGGCCAGGTGG + Intergenic
1091051969 11:132380380-132380402 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1091776578 12:3188665-3188687 TGAGGCCCAATGTGTCCAGGTGG - Intronic
1092093853 12:5825592-5825614 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1092381850 12:8003043-8003065 AGGAGTCCAAAGTGTCCAGGTGG - Intergenic
1092922261 12:13243107-13243129 TGGAGCCCAAAGTGGCTGGGTGG + Intergenic
1093031584 12:14293975-14293997 AGGAGCTCAAAGTGTCCAGGTGG + Intergenic
1093048697 12:14483443-14483465 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1093049444 12:14489343-14489365 AGGATCCCAAAGTATCCAGGTGG + Intronic
1093638455 12:21498520-21498542 AGGAACCCAAAGTGGCCAAGTGG - Intronic
1093645943 12:21585294-21585316 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1093753037 12:22822195-22822217 AGAATCCCAAAGTGGCCCGGTGG - Intergenic
1093964765 12:25312568-25312590 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1093981389 12:25479154-25479176 AGGAGCCCAAAGTGTACAGGTGG + Intronic
1094045226 12:26159430-26159452 GAGAGCCCATAGTGTCCTGGAGG + Intronic
1094102758 12:26780903-26780925 AGGAACCCAAAGTGTCCAGGTGG - Intronic
1094389560 12:29934579-29934601 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1095604123 12:44046282-44046304 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1095745535 12:45654217-45654239 AGGAGCCCACTGGGTCCAAGAGG + Intergenic
1095844163 12:46728332-46728354 AGGAGCCCAAAGTGTTCAGGTGG + Intergenic
1095856027 12:46862048-46862070 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1095896120 12:47281899-47281921 AGGAGCAAAAACTGACCAGGAGG + Intergenic
1096288999 12:50324893-50324915 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1096457227 12:51797805-51797827 GGTAGCCCAAAGTGGCTAGGTGG + Intronic
1096974584 12:55692883-55692905 AGGAGCCCAGCATGTCCTGGTGG - Exonic
1097268798 12:57761557-57761579 AGGAGGCCAAGGTGTGGAGGAGG + Intergenic
1097437597 12:59570622-59570644 AGAAGCCCAAAGTATCCAGGTGG + Intergenic
1097518495 12:60637679-60637701 AGGAGTCCAAAGTGTCCGGGTGG - Intergenic
1097554807 12:61123245-61123267 AGGAACCTAAAGTGGCCAGGTGG - Intergenic
1097564423 12:61250792-61250814 AGAGCCCCAAAGTGTCCAGTTGG + Intergenic
1097821116 12:64130275-64130297 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1097842981 12:64339905-64339927 TAGAGCCCAATGTGTCCAGGTGG + Intronic
1097843111 12:64341111-64341133 AGGAGCCCAATGTGTCCAGGTGG + Intronic
1098673246 12:73255888-73255910 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1098731324 12:74039334-74039356 AGGAGCCCAAAGTGTCCAGATGG - Intergenic
1098745934 12:74236642-74236664 AGAAGCCCAAAGTGGCTGGGTGG - Intergenic
1098750052 12:74281235-74281257 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1098831694 12:75372391-75372413 AGGAGCCCAGAGTAACCAGGTGG + Intronic
1099183165 12:79490960-79490982 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1099366147 12:81767024-81767046 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1099379164 12:81934905-81934927 AAGAGCCCAAAGTGTCCAGGTGG + Intergenic
1099578278 12:84407039-84407061 AGGAACCCAAAGTGTCCAGGTGG - Intergenic
1099632528 12:85168433-85168455 AGGAGCACAAAGTAGCCAGGTGG + Intronic
1099700659 12:86077918-86077940 AGGAGCCCAAAATGTCCAGGTGG + Intronic
1099736053 12:86567364-86567386 AGGAGCCCAAAGTGGCCAGGTGG - Intronic
1099804251 12:87498033-87498055 AGGAATCCAAAGTGGCCAGGTGG + Intergenic
1099994986 12:89768752-89768774 GGGAGTTCAAAGTGGCCAGGGGG + Intergenic
1100112269 12:91259974-91259996 AGGAGTTCAAAGTGCACAGGGGG + Intergenic
1100240913 12:92709963-92709985 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1101264368 12:103067774-103067796 GAGAGCCCAAAGTGTCCAGGTGG - Intergenic
1101534381 12:105604113-105604135 AGGCACCCAAAGTGTCCTGGTGG + Intergenic
1101543288 12:105684278-105684300 ATGAACCCAAAGTGTCTAGGTGG - Intergenic
1101602753 12:106224679-106224701 AAGAGCCCAAAGTTTCCATCAGG + Intergenic
1102024957 12:109709284-109709306 AGGAGACTAAAGTGGCCAGAAGG + Intergenic
1103035860 12:117655709-117655731 AGGAGCTCAAAGTGTCCAGGTGG - Intronic
1103097864 12:118146483-118146505 GGGAGGCCAAAGTGGTCAGGAGG - Intergenic
1103369597 12:120408776-120408798 AGGAGGCATGAGTGTCCAGGAGG - Intergenic
1104148022 12:126054287-126054309 AGGGGCCTAAGGTGGCCAGGTGG - Intergenic
1104357719 12:128102551-128102573 AGGAGCCAAAAGGGACCTGGGGG + Intergenic
1104498542 12:129263557-129263579 AGGAGGCCACAGTGATCAGGAGG + Intronic
1104685259 12:130780691-130780713 AGGAGCCCACAGTGGGCAGCAGG - Intergenic
1105740347 13:23316819-23316841 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1106046063 13:26143392-26143414 AGGAGCCCAAAGTGGCCATATGG + Intronic
1106770502 13:32956950-32956972 AGGAGCCCAAAGTGCCTGGGTGG + Intergenic
1107275536 13:38674343-38674365 AGAAGTTCAAAGTGGCCAGGTGG - Intergenic
1107505375 13:41028189-41028211 AGGAGCCCAAAGTGGCTGGATGG - Intronic
1107983353 13:45754323-45754345 AGGAGCCCAAAATGTCCAGGTGG + Intergenic
1108904494 13:55451600-55451622 AGGAGCACAAAGTGTCCAGGTGG - Intergenic
1108914083 13:55587259-55587281 AGAAGCACAAAGTGTCCAGGTGG + Intergenic
1109009430 13:56921673-56921695 AGGAGCCCAAAGTGGCTAGGGGG - Intergenic
1109069653 13:57748236-57748258 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1109516109 13:63444051-63444073 AGGAGCCCAAACTATCCAGGTGG - Intergenic
1109583314 13:64368135-64368157 AGGATCCCAAAGTGTCCAGGTGG - Intergenic
1109712460 13:66179207-66179229 AAGATCCCAAAGTGGCCAGGTGG + Intergenic
1109931829 13:69226053-69226075 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1109950800 13:69500575-69500597 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1110377384 13:74808149-74808171 AGGAGTCCAAAATGTCCAGGTGG - Intergenic
1110377549 13:74809678-74809700 AGGAGTCCAAAATGTCCAGGTGG + Intergenic
1110661454 13:78062820-78062842 AGGTGGCCAAAGTGTAAAGGAGG - Intergenic
1110833914 13:80062979-80063001 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
1111057572 13:82971391-82971413 AGGAGCCCAAAGGGTCCAGGTGG + Intergenic
1111198753 13:84906528-84906550 AGCAGCCCAAAGTGGCCAGGTGG - Intergenic
1111208876 13:85050427-85050449 TGGAGCGCAAAGTGTCCAGGTGG + Intergenic
1111363395 13:87207363-87207385 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1111536088 13:89604971-89604993 AGGAGCACAAAGTAACCAGGTGG + Intergenic
1111769351 13:92577190-92577212 AGGGAACCAAAGTCTCCAGGAGG - Intronic
1112230893 13:97588527-97588549 AGGAGCCCAAAGCATCCAGGTGG + Intergenic
1112832611 13:103472058-103472080 AGGAGCACAAAGTGGCCAGGTGG + Intergenic
1112875870 13:104037554-104037576 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1113028289 13:105965066-105965088 AGGAGGCCAAAATCTCCAGGTGG - Intergenic
1113396367 13:109951248-109951270 TGGAGCCCAAAGTGTTCAGGTGG - Intergenic
1114748946 14:25182205-25182227 AGGAGCCCCAAATGACCAGATGG + Intergenic
1114758028 14:25282240-25282262 GGGAACCCAAAGTGTCCAGGTGG + Intergenic
1114905163 14:27118914-27118936 AGGACCCCAAAGTGTCCAGATGG + Intergenic
1115070925 14:29320849-29320871 AGAAGCCCCAAGTGGCCAGTTGG - Intergenic
1115130907 14:30050902-30050924 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1116059121 14:39898559-39898581 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1116068313 14:40010801-40010823 AGGAGCCCAAAATGACCAGGTGG - Intergenic
1116249266 14:42459276-42459298 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1116415297 14:44671005-44671027 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1117217076 14:53561798-53561820 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
1117596048 14:57328236-57328258 AGAAGCCCAAAGTGTCCAGGTGG + Intergenic
1117634353 14:57726018-57726040 AGGATCCCAAAGTATCCAGTTGG - Intronic
1117814139 14:59580051-59580073 AGTAGCCTAGATTGTCCAGGTGG + Intergenic
1118122207 14:62858543-62858565 AAGAGCCCAAAGTGTCCAGGTGG + Intronic
1118385103 14:65249638-65249660 AGGAGTCCAAAGTGGCCAGGTGG + Intergenic
1118799333 14:69174861-69174883 CAGAGCCCAAAATGGCCAGGTGG + Intergenic
1118950530 14:70432935-70432957 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
1119059474 14:71460552-71460574 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1119107320 14:71937202-71937224 AGTATCCCAAACTGTCCAGGTGG + Intronic
1119602504 14:75985990-75986012 CGGAGCCCACAGTGGCCTGGGGG - Intronic
1120081795 14:80225891-80225913 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1120198941 14:81516258-81516280 AGAAGGCCACAGTGTCCAGGAGG - Intronic
1120350575 14:83352583-83352605 AGGACCCCAAAGTGTCCAGGAGG - Intergenic
1120498185 14:85261954-85261976 AAGAGCACGAAGTGTCCAGGTGG + Intergenic
1120538488 14:85726581-85726603 AGGCTCCCAAAGTGTTAAGGTGG + Intergenic
1120555794 14:85928997-85929019 AGGAGCTCAAAGTTTCCAGGTGG + Intergenic
1120594468 14:86416797-86416819 AGGAATCCAAAGTGTGCAGATGG + Intergenic
1120973929 14:90232450-90232472 AGTAGCCCAAAGTGTCCAGGTGG - Intergenic
1121070683 14:91017852-91017874 AGGAGCCCAAAGTGGCCATGTGG - Intronic
1122214791 14:100195824-100195846 ACGAGCTCCAAGTATCCAGGAGG - Intergenic
1122304071 14:100750419-100750441 AGGAGCTCAAAGTGACCGGATGG - Intergenic
1122406245 14:101502847-101502869 AGGGGACCAAGGTTTCCAGGGGG - Intergenic
1122580421 14:102768353-102768375 ACGAGGCCAACGTGTCCTGGGGG - Intergenic
1122694576 14:103546510-103546532 AGGAGCACAAATTACCCAGGAGG + Intergenic
1123128341 14:105965846-105965868 AGGGGCCCAAAGTGGCCAGGTGG - Intergenic
1202935261 14_KI270725v1_random:82064-82086 AGGACCCCAAAGCGTCCAAGTGG + Intergenic
1123408869 15:20042003-20042025 AGTGGCCCAAAGTGGCCAGGTGG - Intergenic
1123518200 15:21048713-21048735 AGCGGCCCAAAGTGGCCAGGTGG - Intergenic
1124141927 15:27084793-27084815 AGGAGGCCAGGGTCTCCAGGGGG + Intronic
1124179172 15:27456835-27456857 AGGAGCCCAAAGTCCTCAGAGGG + Intronic
1124647458 15:31448845-31448867 AGGAGCTCAAAGTGGCCGGATGG + Intergenic
1125079948 15:35660725-35660747 AGGAGCACAAAGTGACCAAGAGG + Intergenic
1126231140 15:46326584-46326606 AGAACCCCAAAGTGGCCTGGTGG + Intergenic
1127357011 15:58209874-58209896 AGGAGCCCAAAGAGTCCAGGTGG - Intronic
1128643029 15:69353879-69353901 AGAAGCCCAAAGTGGCTGGGTGG - Intronic
1128791503 15:70437945-70437967 TGGGGCCCAAGGTCTCCAGGAGG - Intergenic
1130290250 15:82592747-82592769 AGGTGGCCAAAGTGCCGAGGTGG + Intronic
1130377136 15:83339183-83339205 AGAAGCCCAAAGTGGCCAGGTGG - Intergenic
1130958953 15:88647157-88647179 AGTAGCCCATGGTGGCCAGGAGG + Intronic
1131658920 15:94492933-94492955 GGGATCCCAAAGTGTCCAGGTGG - Intergenic
1131724237 15:95204441-95204463 AGAAGCCCAAAGTGGCCAGGTGG - Intergenic
1132092439 15:98957247-98957269 AGGAGGCCGAGGGGTCCAGGGGG - Exonic
1132217834 15:100080265-100080287 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1132505051 16:303846-303868 AGGAACCAAAAGTGACCAGGAGG + Intronic
1132752776 16:1466404-1466426 AGGAGCCCACAGGGCCGAGGTGG + Intronic
1134090923 16:11391298-11391320 ATGAGCTCAATGTGGCCAGGTGG - Intronic
1136251173 16:29006208-29006230 AGAAGCCTGAAGTGTCCGGGTGG - Intergenic
1137424394 16:48365529-48365551 AGGAGCAGAAAGAGCCCAGGAGG - Exonic
1137948177 16:52755968-52755990 AGGAGGCCAGAGTAACCAGGAGG + Intergenic
1138776114 16:59725912-59725934 AGGAACCCCAAGTGGCCAGGTGG + Intronic
1138868605 16:60852415-60852437 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1139237550 16:65355855-65355877 GGGAGCCCAAAGTGACCTGGTGG - Intergenic
1141535567 16:84677517-84677539 AGGAGCCAGAAGTGACCAGGAGG - Intergenic
1141559309 16:84856395-84856417 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1141638542 16:85328470-85328492 AGGAGCCTGGAGTGTCTAGGCGG - Intergenic
1142004973 16:87685364-87685386 CGCACCCCAAAGTGTCCAAGTGG + Intronic
1142201668 16:88763994-88764016 AGGAGCCCACAGCCTCCTGGGGG + Intronic
1143925356 17:10364687-10364709 AGGAGCTTAAAGTGTGCAAGTGG + Intronic
1144403922 17:14934124-14934146 AGAAACCCAAAGTGACCATGTGG + Intergenic
1144801382 17:17930461-17930483 AGGAGCCCCAAGTGTCAGGAGGG - Intronic
1144944442 17:18962613-18962635 AAGTGCCCAAGGTGCCCAGGTGG + Intronic
1146758657 17:35455774-35455796 AGGTGCCCAAAGTGTCCAGGTGG - Intergenic
1147054205 17:37821744-37821766 AGGAGCTCACAGTGTACTGGGGG - Intergenic
1147155335 17:38541975-38541997 AGGAGCCCAGAGGCTCCAGGTGG + Intronic
1148635464 17:49145870-49145892 AGGAGTCCAAAGTGTCCAGGTGG + Intronic
1149255108 17:54817083-54817105 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
1149358983 17:55873136-55873158 AGGAACGCAAGGTGGCCAGGTGG + Intergenic
1149421018 17:56510965-56510987 AGGAGCCCAAGGAGGCCAAGCGG + Intronic
1149427280 17:56567349-56567371 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1150815628 17:68389940-68389962 TGGACCCCAAGGTGTGCAGGTGG - Intronic
1150921908 17:69492756-69492778 ATGAGCCTAAATTATCCAGGTGG - Intronic
1151037583 17:70819979-70820001 AGGATCCCAAAGTGTCCAGGTGG + Intergenic
1151277806 17:73049158-73049180 AGGAGCTCAAAGTTTCAAGCAGG + Intronic
1151698480 17:75730366-75730388 AGGTGCCCGTGGTGTCCAGGTGG - Exonic
1151730873 17:75910389-75910411 GGGAGCCCACAGAGCCCAGGGGG + Intronic
1151807947 17:76418241-76418263 AGGAGCCCACAGCCTCCCGGAGG + Intronic
1152700060 17:81814232-81814254 TGGTGGCCAAAGCGTCCAGGGGG - Intergenic
1153089948 18:1331800-1331822 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1153131045 18:1856089-1856111 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1153216013 18:2821647-2821669 AGGAGTCCAACGTGGCCAGATGG + Intergenic
1153217457 18:2833971-2833993 AGGAGCCCAAAGTGTCTGGGTGG + Intergenic
1153461750 18:5342060-5342082 AGGAGCCCAAAAGGGCCAGATGG - Intergenic
1153685006 18:7536920-7536942 AGGAACTCAAAGTGGCTAGGTGG + Intergenic
1154068688 18:11132722-11132744 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1154252333 18:12755119-12755141 AGGAGCCCAAAATGTCCAGGTGG + Intergenic
1154273024 18:12936289-12936311 AGGAGCCCCAAGTGGCTGGGTGG + Intergenic
1154506377 18:15044514-15044536 AGGAGCCCAAAGTGTCCAAGTGG - Intergenic
1155428052 18:25726539-25726561 AGGAGCACAGAGTGCCCAGGTGG + Intergenic
1155468052 18:26161090-26161112 AGGAGTCCAAAATGGCCAAGTGG + Intronic
1155741726 18:29297674-29297696 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
1156118653 18:33817342-33817364 AGGATTCCAAAGTGGCCAGGTGG - Intergenic
1156304075 18:35860335-35860357 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1156337214 18:36182702-36182724 AGGAGGCCAAGGTTTTCAGGGGG + Intergenic
1156537793 18:37880563-37880585 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1156990088 18:43399143-43399165 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1156998804 18:43499368-43499390 AGGAGCCCAAAGTACCCAGGTGG - Intergenic
1157042952 18:44061356-44061378 TGGTGCCCAAAGTGTGGAGGGGG + Intergenic
1157341436 18:46781652-46781674 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1157998281 18:52586485-52586507 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1158671380 18:59477082-59477104 AGGAGACCAAAGTAGCCAGGTGG - Intronic
1159151688 18:64531058-64531080 AGAAGCCAAAAGTGGCCAGATGG + Intergenic
1159207691 18:65274720-65274742 AAGAGCCCAAAGTCTCTGGGTGG - Intergenic
1159288001 18:66377110-66377132 AGGAGCTCAAAGTGTCCAGGTGG - Intergenic
1159456277 18:68663328-68663350 AGGAACTCAAAGTGGCCAGGTGG - Intergenic
1159558881 18:69973741-69973763 AGGAGCCCAAAGTGTTTAGGTGG + Intergenic
1159711562 18:71766073-71766095 AGGAGCCCAAAGTTGCCAGGTGG - Intronic
1159767813 18:72510838-72510860 AGGAGCCCAAAGTGCCAGGTGGG - Intergenic
1160092666 18:75841641-75841663 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1160191198 18:76715201-76715223 AGGACCCCGCAGTGTCCTGGCGG - Intergenic
1160884924 19:1341374-1341396 AGGAGCACCCAGAGTCCAGGTGG + Intergenic
1161115356 19:2493828-2493850 AGGAGCACACAGAGACCAGGAGG - Intergenic
1161626593 19:5330565-5330587 AGGAGCCCAAGGTGCACAGGAGG - Intronic
1161736398 19:5994774-5994796 AGGTTCCCAGAGTGACCAGGCGG + Exonic
1161738208 19:6004625-6004647 AGCACCCCACAGTGCCCAGGAGG + Intronic
1162136392 19:8557934-8557956 AGGAGCTCAAAGGGACCAGCTGG - Intronic
1163734706 19:18972571-18972593 AGGAGCTCAGACTGGCCAGGGGG - Intergenic
1165339083 19:35197746-35197768 AGGAGCCCAAAGTAGCCAGGGGG - Intergenic
1165497371 19:36161055-36161077 AGGACCTCAAAATGTTCAGGTGG + Intergenic
1168291123 19:55358254-55358276 ACGACCCCACAGTGGCCAGGGGG + Exonic
1168539106 19:57195773-57195795 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
925105323 2:1286061-1286083 AGAAGCCCAAAGTGTCCAGGTGG + Intronic
925277613 2:2661591-2661613 AGGAGCCAGAAGAGTCAAGGAGG + Intergenic
925280184 2:2678489-2678511 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
925336240 2:3101187-3101209 TGGAGCCGAGAGTGTCCAGCAGG + Intergenic
925460963 2:4062085-4062107 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
925499176 2:4485293-4485315 AGGAACCCAAAGTGTCTAGGTGG + Intergenic
925772519 2:7297379-7297401 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
926810168 2:16749071-16749093 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
926826989 2:16915303-16915325 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
927008936 2:18881343-18881365 TGGAGCCCAAAGTGTCCAGGTGG - Intergenic
927240574 2:20916708-20916730 AAGAGCCAGAACTGTCCAGGAGG - Intergenic
927660650 2:24990299-24990321 AGGAGCCCAAAGTGGCCAAGTGG - Intergenic
927816621 2:26223170-26223192 AGGAGCCCAAAGTGGCCAGATGG - Intronic
929269599 2:39959163-39959185 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
929386807 2:41417688-41417710 AGGAGCCCAGATTGGCCAGATGG + Intergenic
930132737 2:47869316-47869338 AGGAGTCCAAAATGGCCAGGTGG - Intronic
930149730 2:48046246-48046268 AGGAGCTCAAAGTGGCCAAGTGG - Intergenic
930294978 2:49543738-49543760 AGGAGCCCAAAGCGCCCAGGCGG + Intergenic
930480947 2:51947627-51947649 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
930536398 2:52650624-52650646 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
930910357 2:56622505-56622527 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
931300424 2:60973540-60973562 TGGTGCCCAAAGTCTACAGGGGG - Intronic
931629270 2:64284796-64284818 TGCAGCCCAAAGGGACCAGGGGG + Intergenic
933103100 2:78284648-78284670 AGGAGCCCAAAGTGGCCTGCTGG - Intergenic
933265484 2:80176836-80176858 GGGAGCCCAAAGTGGCCAAGTGG + Intronic
933394245 2:81711720-81711742 AGGAGCCCAAAGTGCCCAGGTGG + Intergenic
933504558 2:83161130-83161152 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
934305967 2:91822229-91822251 AGGACCCCAAAGCGTCCAAGTGG - Intergenic
934327289 2:92030513-92030535 AGGACCCCAAAGCGTCCAAGTGG + Intergenic
934465672 2:94261093-94261115 AGGACCCCAAAGCGTCCAAGTGG + Intergenic
935424882 2:102909695-102909717 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
935564078 2:104588617-104588639 AGGAACCCAAAACATCCAGGTGG + Intergenic
935846349 2:107169877-107169899 GGGAGCTCAGAGTTTCCAGGAGG + Intergenic
935921658 2:108022259-108022281 GGGAGCTCAAAGTGTCCAAGTGG - Intergenic
936641439 2:114316332-114316354 AGAAGCCCAAAGTGGCCAGGTGG - Intergenic
937581845 2:123497498-123497520 AGGAACCCAAAGTGTCTAGGTGG + Intergenic
937765856 2:125659636-125659658 AGGAACCCAAAGTGTCCAGGTGG - Intergenic
937784982 2:125886090-125886112 AGGAGCTCAAAGTGTCCAGGTGG + Intergenic
937802553 2:126097193-126097215 AGGAGGCCAAAATGTCCATGTGG - Intergenic
937852351 2:126647113-126647135 AGGATCCCAAAGTGTCCAGGTGG + Intergenic
938204107 2:129402561-129402583 AGGAATCCAAAATGGCCAGGTGG - Intergenic
939003161 2:136758698-136758720 AGGAGCCCAAGGTGGGGAGGCGG - Intergenic
939214091 2:139213879-139213901 AGGAGCCCAAAGTATCCAGGTGG - Intergenic
939788453 2:146544473-146544495 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
939806463 2:146780100-146780122 AGAAGCTCAAAGTGGCCAGGTGG - Intergenic
939976160 2:148719836-148719858 AGGAGCCCAAACAGCCAAGGTGG + Intronic
940171087 2:150831065-150831087 AGGAGCATAAAGTGTCCAGATGG + Intergenic
940544157 2:155062053-155062075 AGGAGCCCAAAGTGGCTGGGTGG + Intergenic
940676726 2:156732542-156732564 AGGAGCCCAAAGTGACCAGGTGG - Intergenic
940995534 2:160145595-160145617 AGGAGCCCAGGATGTGCAGGTGG - Intronic
941330440 2:164172927-164172949 AGAAGCCCAAGGAGTCCAGGTGG + Intergenic
941387013 2:164866241-164866263 AGGAGCCAAAAGTGTCCAGGTGG - Intergenic
941668250 2:168262739-168262761 AGGGGCCCAAAGTGTCCAGGTGG - Intergenic
942025640 2:171907973-171907995 AGAAGCCCAAAATCTCCAGGAGG - Intronic
942322156 2:174745181-174745203 AGGAGCTCGAAGTGGCCAGGTGG - Intergenic
943021159 2:182575399-182575421 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
943263752 2:185698874-185698896 AGGAGCCCAAAGTGGTCTGGTGG - Intergenic
943383844 2:187179453-187179475 AGAAGCCCAAAGTGTCCAGGTGG + Intergenic
943480390 2:188410667-188410689 AAGAGCCCAAAGTGGCTATGTGG + Intronic
943517361 2:188905616-188905638 AGAAGGCCAAAGTATCCAGGTGG + Intergenic
943879538 2:193122734-193122756 AGGAGCCTACAGGCTCCAGGAGG - Intergenic
945545070 2:211139753-211139775 AAGAATCCAAAGTGTCCAGGTGG - Intergenic
945642405 2:212445478-212445500 AGGATCCTAAAGTGTCTAGGTGG - Intronic
945717613 2:213379031-213379053 AGGAGCCCAAAGTGTCCAAGTGG + Intronic
945725626 2:213469861-213469883 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
945793261 2:214331374-214331396 ATGAGCCTGAAGTGACCAGGTGG + Intronic
946527598 2:220538044-220538066 AGGAGCCCAAAGTGTCCACGTGG + Intergenic
946527648 2:220538450-220538472 AGGAGCCCAAAGTGTTCAGGTGG + Intergenic
946533886 2:220606248-220606270 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
946703532 2:222436158-222436180 AGGAGCCCAAAGTGTCCAGATGG + Intronic
946901666 2:224379158-224379180 AGCAGTCCATATTGTCCAGGGGG + Exonic
946949755 2:224860818-224860840 AGGAGGCCAAGGTCTCCTGGAGG - Intronic
947281797 2:228463370-228463392 AGAAGCCCAAAGTGTCCAGGTGG + Intergenic
1168825322 20:808994-809016 AGGAGCCCAAAGTCTTCCTGAGG + Intergenic
1169185887 20:3616793-3616815 AGGAGTCCAGGGAGTCCAGGTGG + Intronic
1169572135 20:6917975-6917997 AGGACCACAAAGTATCCAGTTGG - Intergenic
1171354968 20:24536881-24536903 TGGACCCCAAAGTTTCCTGGAGG + Intronic
1172038898 20:32029982-32030004 AGGAGCCCAAAGTGCAGAGTAGG + Intronic
1173599366 20:44282067-44282089 AGGAGCTCAAAATGGCCAAGTGG + Intergenic
1175931124 20:62494215-62494237 ATGACCCCAAATTATCCAGGGGG - Intergenic
1176596679 21:8704300-8704322 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1176791477 21:13324509-13324531 AGGAGCCCAAAGTGTCCAAGTGG + Intergenic
1176998393 21:15581898-15581920 AGGAGCCTAAAGTGTCCAGGTGG - Intergenic
1177139194 21:17340626-17340648 AGAAGCCCAAAGTGTCCAGGTGG + Intergenic
1177267936 21:18808578-18808600 AGGAGACCAAAGTGTCCAGGTGG - Intergenic
1177505338 21:22012581-22012603 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1177780764 21:25620498-25620520 GGGAGCCCAAAGTGGCCAAGTGG + Intergenic
1177913406 21:27057858-27057880 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
1177990310 21:28028806-28028828 AAGAGCCCAAAGTGTCCAAGTGG - Intergenic
1178005813 21:28218796-28218818 AAGAGCCCAAAGTGTCCAGGTGG + Intergenic
1178061916 21:28861998-28862020 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1178634599 21:34291155-34291177 AGGAGCCCAAAGTGGCTAGGTGG - Intergenic
1179030961 21:37719095-37719117 AGGAGCCCCGAGGGGCCAGGAGG + Intronic
1179414913 21:41190894-41190916 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1180107639 21:45630372-45630394 AGGAGGCCAAAGTGGCCAAATGG + Intergenic
1180279600 22:10681742-10681764 AGGACCCCAAAGCGTCCAACTGG + Intergenic
1180586812 22:16900272-16900294 AGGACCCCAAAGCGTCCAAGTGG + Intergenic
1180590917 22:16936728-16936750 AGGAGCCCAAAGTGCCCAGCTGG + Intergenic
1180622216 22:17169701-17169723 AGCAGCCCCAGGTCTCCAGGCGG + Intergenic
1180635312 22:17258808-17258830 AGCAGCTCAAAGAGGCCAGGAGG + Intergenic
1180738070 22:18033604-18033626 AGGAACTGAAAGTTTCCAGGAGG + Intergenic
1181309636 22:21937641-21937663 AGGAGCCCACAGTTTCCAGAGGG - Intronic
1181367090 22:22386258-22386280 AGAAGCCCAAAATGTCCAGGTGG + Intergenic
1181373493 22:22437540-22437562 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1181664925 22:24388034-24388056 AGGATCCTGAATTGTCCAGGTGG - Intronic
1182052145 22:27321569-27321591 AGGAGACCAAAATGTCCTGTTGG - Intergenic
1182765759 22:32757266-32757288 AGGAGCCCAAAGTGTCCAGATGG - Intronic
1182965904 22:34520716-34520738 AGAAGCCCGAAGTGTCCGGGTGG - Intergenic
1184157941 22:42680940-42680962 AGGAGCCTAACATGGCCAGGTGG - Intergenic
1184465554 22:44667466-44667488 AGGGGCCTAAAGTGTCTGGGTGG - Intergenic
1184603325 22:45556724-45556746 AGGAGCTTCAAGTGTCCAGGTGG + Intronic
1185141875 22:49107020-49107042 AGGAGCCCAGTGTCTCCAGGAGG - Intergenic
1185258816 22:49850345-49850367 AGGACTCCAGAGCGTCCAGGTGG - Intergenic
1185323062 22:50210690-50210712 AGCAGCCCGAGGTGTGCAGGTGG + Exonic
949125433 3:441453-441475 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
949169804 3:984968-984990 AGGAGACCAAAGTGTCCAGGTGG + Intergenic
949246102 3:1926535-1926557 AGGACCCCAAAGTGTCCAGGTGG - Intergenic
949417361 3:3829271-3829293 GGGAGCCCAAAGTGTCCAGGTGG + Intronic
949445841 3:4132699-4132721 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
949906134 3:8860009-8860031 ACGGGCCCAAAGTGGCAAGGTGG - Intronic
950204819 3:11071302-11071324 AGGAGCCCACAGTGGGGAGGGGG + Intergenic
950392499 3:12707660-12707682 AGGAGCCTGAAGTGACCAGGTGG + Intergenic
950609349 3:14115671-14115693 AGGAGCCCATATTCTCGAGGCGG + Intronic
950884190 3:16348493-16348515 TGGAGCCCACTGTGTCCAGGAGG + Intronic
951003788 3:17594126-17594148 AGGTGCCCAAAGTGTCCAGGTGG - Intronic
951086771 3:18520914-18520936 AGGAACCCAAAGTCTCCAGGTGG - Intergenic
951384748 3:22029156-22029178 AGGAGCACAAAGTGTCCAGGTGG - Intronic
951807607 3:26663804-26663826 AGGAGCCCAAACTGGCAAGATGG - Intronic
951970553 3:28440255-28440277 AGAAGCCCAAAGTGTCCAGGTGG + Intronic
952196444 3:31080647-31080669 AGGAGGACAAAGTCTCCAGCAGG - Intergenic
952587555 3:34911022-34911044 AGGAGCCCAAAGCGGCCAGATGG + Intergenic
953498290 3:43407745-43407767 AGGAGGAGAAATTGTCCAGGAGG + Intronic
953804924 3:46060518-46060540 AGGAGCCCAAAGTGGCAGGGTGG + Intergenic
954395966 3:50293467-50293489 AGGGGCCCAAGGTGTCCACCAGG + Exonic
954442188 3:50527908-50527930 AGGAGCTCAGAGTGGGCAGGGGG - Intergenic
954511268 3:51128050-51128072 AGGATCCCAAAGTGTCCAGGTGG + Intronic
955241091 3:57178900-57178922 AGGAGTCCAAAATGGCCATGTGG - Intergenic
955478582 3:59365772-59365794 GGAAGCCCAAACTATCCAGGTGG + Intergenic
955638357 3:61054855-61054877 GGGACCCCAAAGTGTCCCAGGGG - Intronic
956307087 3:67837270-67837292 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
956360379 3:68440877-68440899 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
956703675 3:71981261-71981283 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
957634444 3:82762063-82762085 AGAAGGCCAAAGTGAACAGGTGG - Intergenic
957744140 3:84316952-84316974 AGGAATCCAAAGTGGCCAGGTGG + Intergenic
957754804 3:84471068-84471090 AGGAGCACAAAGTGTCCAGGTGG - Intergenic
958024866 3:88038811-88038833 AGGAGCCCAAAGGGCCCAAGAGG + Intergenic
958667439 3:97159309-97159331 AGAAGCACAAAGTGGCCAGGTGG + Intronic
958745145 3:98125263-98125285 AAGAGACCAAAGTGGCCTGGTGG + Intergenic
958761906 3:98319507-98319529 ATGAACCTAAAGTGGCCAGGTGG + Intergenic
958845560 3:99260788-99260810 AGGAGCCCAAAGTGACCAGGTGG + Intergenic
959226564 3:103595647-103595669 AGGAGCCCAAAGTGTCCAGTTGG + Intergenic
959289218 3:104450953-104450975 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
959434839 3:106301857-106301879 AGGATCCTAAAGTCTCCTGGTGG - Intergenic
959745794 3:109775638-109775660 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
959916577 3:111823131-111823153 AGGAGGCCTAAGGGACCAGGAGG + Intronic
960127125 3:114012062-114012084 ATGACCCCAAAGAGTCCATGAGG - Intronic
960349740 3:116577341-116577363 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
960494525 3:118359121-118359143 AGGAGCACAAAGTGTCCAGGTGG + Intergenic
961263077 3:125618036-125618058 AGGAGCCAAAAGTGTTCAGGTGG - Intergenic
961511840 3:127408243-127408265 AGGAGGCCAAGGTGCCCATGAGG + Intergenic
961710753 3:128826382-128826404 AGGAGCCCAAAGTGGTCAGTTGG + Intergenic
962032943 3:131620621-131620643 AGAAGCCCAGATTATCCAGGTGG + Intronic
962591492 3:136894149-136894171 AGAAGCCCATAGTGACCAAGTGG + Intronic
963331589 3:143921759-143921781 AGGAACCGAAAGTGTCCAGGTGG + Intergenic
963630531 3:147724855-147724877 AGGAACCCAAAGTGTCCAGGTGG - Intergenic
963661640 3:148134079-148134101 AGGAGCCAAAAGTGGCCAAGTGG - Intergenic
963970089 3:151420319-151420341 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
964146732 3:153472977-153472999 AGGATCCCAAAGTGTCCAGGTGG - Intergenic
964679008 3:159317274-159317296 AGAAGCCCAAAGTGTCCAGGTGG + Intronic
965034782 3:163424298-163424320 AGGAGCCCAAACTGTCCAGGTGG + Intergenic
965071221 3:163917306-163917328 AAGAGCCCCAAGTGGCCAGGTGG - Intergenic
965996004 3:174884034-174884056 AGGAGCCCGAAGAGTCCAGGTGG + Intronic
966044105 3:175529270-175529292 AGGAGCCCAAAGTGTCCAGATGG + Intronic
966445914 3:180000210-180000232 AGGAGCTCAAAGTGTCCAGGTGG - Intronic
966736335 3:183189906-183189928 AGGAGTCCAAAATGACCAGATGG + Intronic
967832017 3:193927625-193927647 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
967929472 3:194680386-194680408 AGGAGCCCATAGTCTACTGGGGG + Intergenic
968800419 4:2739768-2739790 AGGAGCCCAGAGTGTCCAGGTGG - Intergenic
968907246 4:3460050-3460072 AGGAGCCCAGAGTGTCCAGGTGG - Intergenic
969549069 4:7852363-7852385 AGGAGCCCAGTGTGGCCAGGTGG - Intronic
970486059 4:16525975-16525997 AGGAGCCTGAATTGTCCAGGTGG + Intronic
970629508 4:17925139-17925161 GGGATCCCAAAGTAGCCAGGTGG - Intronic
970644852 4:18108333-18108355 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
970704450 4:18783254-18783276 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
970729723 4:19088672-19088694 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
971100789 4:23464784-23464806 AGGAGCCCAAAGTGTCCAGATGG + Intergenic
971460297 4:26888955-26888977 AGGAGTTCAAAGTGGCCAGGTGG + Intronic
971514997 4:27474595-27474617 AAGAGTCCAATGTGTGCAGGTGG - Intergenic
971687158 4:29785454-29785476 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
971817446 4:31506706-31506728 AGAAGCCCAAAGTGTCCAAGTGG - Intergenic
971857444 4:32061210-32061232 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
971897742 4:32619041-32619063 GGGAGCCCAAAGTGGCTGGGTGG - Intergenic
972085432 4:35208723-35208745 AAAAGCCCAAAGTGTCCAGGTGG - Intergenic
972095716 4:35344437-35344459 AAAAACCCAAAGTATCCAGGTGG - Intergenic
972201078 4:36715568-36715590 AGGAGCCCAAATTGCCCAGGTGG + Intergenic
972806154 4:42531014-42531036 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
972882758 4:43446532-43446554 TGGAGCCCAAAGTGTCCAGGTGG + Intergenic
973092798 4:46158721-46158743 AGGAGCCCAAAGTGTCCAGGGGG - Intergenic
973103138 4:46296383-46296405 AGGAACCCAAAGTGTCCAGGTGG - Intronic
973120786 4:46519278-46519300 AGAAGCCCAACATGTCCAGGTGG + Intergenic
973129959 4:46638080-46638102 AGAAGCCCAAAGTGTCCAGATGG + Intergenic
974289784 4:59914373-59914395 AAGAGCCCAAAGTGTCCAGGTGG - Intergenic
974459230 4:62165892-62165914 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
974564999 4:63569946-63569968 AGAAGCCAAAAGTGGCCACGTGG - Intergenic
975135353 4:70869087-70869109 ATGAGCCCAAAGTGACCATGTGG + Intergenic
975399267 4:73915912-73915934 AGGAACCCAAAGTGACCAGGTGG - Intergenic
975527125 4:75363010-75363032 ATGATTCCAAAGTGGCCAGGTGG - Intergenic
975742397 4:77442322-77442344 AGGAGTCCAGTGTGACCAGGTGG - Intergenic
975982389 4:80175637-80175659 AGGACCCCAAAGTGTTCAGATGG + Intergenic
976033984 4:80794195-80794217 AGAAACCCAAAATGTCCAGATGG + Intronic
976324130 4:83751523-83751545 AGGACCCCAGAGTGGCCAGGTGG - Intergenic
977031873 4:91893442-91893464 AGGAGCCCAAAGTGTCCAAGTGG - Intergenic
977080470 4:92520753-92520775 AGGAGCTCAAAGTGGCCAGGTGG + Intronic
977430988 4:96929833-96929855 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
977489867 4:97698440-97698462 AGGAGCACAAAGTGTCCAGGTGG + Intronic
977701520 4:100028259-100028281 AGGAGCCTAAAGTGTCCAGTTGG + Intergenic
977728158 4:100321556-100321578 GGGAGCCCAAAGTGGCCAAGTGG - Intergenic
977833002 4:101616203-101616225 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
977898930 4:102396226-102396248 AGGAGCCCAAAGTGTCGAGGTGG - Intronic
977930182 4:102742182-102742204 AGGAGCCCGAAGTGTCCAGGTGG + Intronic
978341345 4:107723911-107723933 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
978771922 4:112466147-112466169 AGGAGCCCAGAGTGTCCAGGTGG + Intergenic
978898842 4:113925188-113925210 AGGAACCCAAAGTGTCCAGGTGG + Intronic
979051884 4:115945203-115945225 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
979075607 4:116265666-116265688 AGAAGCCCAAAGGGTCCAGACGG - Intergenic
979439447 4:120734098-120734120 TGAGGCCCAGAGTGTCCAGGAGG + Intronic
979507343 4:121513661-121513683 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
979595489 4:122529955-122529977 AGGAACACAAAGTGGCCAAGCGG + Intergenic
979898197 4:126187431-126187453 AGGATTGCAAAGTGTCTAGGTGG + Intergenic
980090999 4:128442738-128442760 AGGAGGCCAGAGTGGCCAGGTGG - Intergenic
980283955 4:130758015-130758037 AGAAGCCTAAAGTGACCACGTGG - Intergenic
980284240 4:130760912-130760934 AGGAACCCAAAGTAACCAGGTGG + Intergenic
980385577 4:132085414-132085436 AGAAGCCCAAAGTGGCCAGGTGG + Intergenic
980405672 4:132352154-132352176 AGAAGCTAAAAGTGTCCAGGTGG + Intergenic
980602437 4:135041644-135041666 AGGAGCGCAAAGTGTCCAGGTGG - Intergenic
980629737 4:135415905-135415927 AGAAGCCCAAAATGTCCAGGTGG - Intergenic
980630061 4:135419376-135419398 TGTAGCCCAAAGTCGCCAGGAGG - Intergenic
980703098 4:136457620-136457642 AGGTGCCCAAAGTCTGGAGGGGG - Intergenic
981066876 4:140495108-140495130 AGGAGGCCAATGTGAACAGGGGG - Intronic
981229749 4:142338938-142338960 AGGAGAACAGAGGGTCCAGGAGG + Intronic
981463033 4:145033416-145033438 AGGAGCCCAAAGTGTACAGGTGG - Intronic
981605642 4:146537460-146537482 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
981835225 4:149045541-149045563 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
982348365 4:154386281-154386303 AGGAGACCACTGTGTCCAGAGGG - Intronic
982443243 4:155460846-155460868 AGGGGGACAAACTGTCCAGGTGG + Intergenic
982566278 4:156991132-156991154 AAGAATCCAAAGTGACCAGGAGG - Intergenic
982597555 4:157405413-157405435 AGGAGACCAAGGTGGCCAGATGG + Intergenic
982623110 4:157731252-157731274 AGTAGCCCAAAGTGTCCAGGTGG + Intergenic
982835767 4:160118256-160118278 AGGAGCCCAAAGTGTCCAAGTGG - Intergenic
982848010 4:160275961-160275983 AGGAGCCCAAAGTGTTCAGGTGG - Intergenic
983027628 4:162756923-162756945 AGGATCCCAAAGTGTCCAGGTGG - Intergenic
983582910 4:169326453-169326475 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
984060063 4:174980398-174980420 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
984329451 4:178296792-178296814 AGGAGCCCAAAATATCCAGGTGG - Intergenic
985076435 4:186219995-186220017 AGGATCTCAAAGTGTCCAGGTGG + Intronic
985773039 5:1824990-1825012 AGGGCTCCAAAGTGGCCAGGCGG - Intergenic
985832540 5:2244957-2244979 AGGAGCTCAAAGTGTCCAGGTGG - Intergenic
985953674 5:3243832-3243854 AGGAGCCCAAAGTGGCTGGGTGG + Intergenic
986036821 5:3948814-3948836 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
986087357 5:4464526-4464548 AGGAGTCCAAAGTGTCCAGGCGG - Intergenic
986147416 5:5091628-5091650 AGGAGCCCGAAGTGTCCAGGTGG + Intergenic
986261415 5:6150886-6150908 AGGAGCCAAAAGTGTCCAGGTGG + Intergenic
986938112 5:12917113-12917135 AGGAGCCCAAAGTGTCCAGATGG + Intergenic
986960054 5:13200810-13200832 AGGAGGCCAAAGTGTCCAGGTGG - Intergenic
987468024 5:18295723-18295745 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
987492739 5:18601239-18601261 AGGAATACAAAGTGTCCAGTTGG - Intergenic
987504610 5:18751477-18751499 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
987737048 5:21859730-21859752 AGGAGCCCAAACTGGCCAGGTGG - Intronic
987737932 5:21869076-21869098 AGGAGCCCAAAGTATCCTGGTGG - Intronic
988056543 5:26105034-26105056 AGGAGCCCAAAGTGTCTAGGAGG + Intergenic
988079597 5:26399778-26399800 AGGAGCCCCAGGTGTCCAAGTGG + Intergenic
988092651 5:26562931-26562953 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
988160602 5:27515231-27515253 AGGAGCCTAAACTCTCCGGGTGG + Intergenic
988228973 5:28449757-28449779 AAGAGCCCAAAGTGTCCAGGTGG - Intergenic
988233088 5:28505452-28505474 AGGAGTCCAAAGTGTCCAGGTGG + Intergenic
988258379 5:28850204-28850226 AGGAGCCCAAAGTGGCAAAGTGG - Intergenic
988267526 5:28971661-28971683 AAAAGCCCAAAGTGTACAGGTGG + Intergenic
988785306 5:34561315-34561337 AGGAGCCAAAGGTGTCCAGGTGG + Intergenic
989044923 5:37265644-37265666 AGGAGCGCAAAGTGTCCAGGTGG + Intergenic
989457418 5:41660125-41660147 AGGACCCAAAAGTGTCCAAGTGG + Intergenic
989486157 5:41994725-41994747 AGGAGCCCAAAATGTCCAGGTGG + Intergenic
990163006 5:52964052-52964074 AGAAGCTCAAAGGGGCCAGGTGG + Intergenic
990191015 5:53260284-53260306 AGAAGCACAAAGTTTCCAAGTGG + Intergenic
991013563 5:61909254-61909276 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
991033782 5:62107559-62107581 AGGAGCCCAAAGTGTTCAGGTGG - Intergenic
991330524 5:65488084-65488106 AGGAGCTCAAAGTGTCCAGGTGG + Intergenic
991936331 5:71804913-71804935 AGTAGCCTGAATTGTCCAGGTGG - Intergenic
991946370 5:71901761-71901783 AGGAACCCAAAGTGTCCAGGTGG - Intergenic
992099862 5:73396647-73396669 AGGAGCACAAATTATTCAGGGGG - Intergenic
992109646 5:73481057-73481079 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
992243181 5:74791493-74791515 AGGAGCCCAAAGTGTCCAAGTGG - Intronic
993132690 5:83919267-83919289 AGGAGCCCAAAGTGGCTGGGTGG - Intergenic
993203619 5:84849179-84849201 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
993231688 5:85245908-85245930 GGAAGCCCAAAGTGTCCAGGTGG + Intergenic
993320754 5:86465777-86465799 AGTACCCTGAAGTGTCCAGGTGG - Intergenic
993367117 5:87048226-87048248 AGGATCCCAAAGTGTCCAGGTGG + Intergenic
993412356 5:87590179-87590201 AGAAGCCAAAACTGTCCAGGTGG + Intergenic
993780892 5:92064018-92064040 AGGAGCCCAAAGTGGCCAAGTGG - Intergenic
993792002 5:92220544-92220566 AGGAGCCCAAAGTTTCCAGGTGG - Intergenic
994291146 5:98030319-98030341 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
994605015 5:101955828-101955850 AGGAGCACGAAGTGTCCAGGTGG + Intergenic
994837168 5:104870838-104870860 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
994917169 5:105995110-105995132 AGGAGCCCAAAGTGTCCAGTTGG - Intergenic
994984191 5:106914101-106914123 AGGAGCCAAAAGTGTCCAGGTGG + Intergenic
995118084 5:108504497-108504519 AGGCACCAAAAGTGTACAGGAGG - Intergenic
995427512 5:112042112-112042134 AGGAGCCCAAAGTATACAGGTGG + Intergenic
995776049 5:115726073-115726095 AGGAGCCCGAAGTGTCCAGGTGG + Intergenic
995793938 5:115922643-115922665 AGGAGCTGAAAGAGTACAGGTGG + Intergenic
996018788 5:118569510-118569532 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
996164741 5:120210878-120210900 AGAAGCCCGAAATGGCCAGGTGG + Intergenic
996391993 5:122972151-122972173 AAGAGCTCATAGTGTCCAGATGG + Intronic
996570558 5:124928872-124928894 AGGAGCCCTAAGTGACTTGGTGG + Intergenic
996601990 5:125274992-125275014 AGAAACCCAAAGTGTCAAGTTGG + Intergenic
996825793 5:127679455-127679477 AGGAGCCCAAACTGTCCAGGTGG - Intergenic
996908736 5:128632316-128632338 AGGAGCCCAAAGTGGCCAAGTGG + Intronic
999545472 5:152624176-152624198 AGGAGTTAAAAGTGGCCAGGTGG - Intergenic
1000417245 5:160995841-160995863 AAGAGCCCAAAGTGTCCAGGTGG - Intergenic
1000499340 5:162029632-162029654 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1000762323 5:165241712-165241734 AGGAGCCCAAAGTGTTCAGGTGG + Intergenic
1001135790 5:169101529-169101551 AGGAGACCAAGGAGTCCTGGAGG - Intronic
1001274911 5:170343580-170343602 TGGAGCCCAAAGTACACAGGAGG + Intergenic
1002032713 5:176442315-176442337 AGGTGTCCAAAGTGTCCAGGTGG + Intergenic
1002691194 5:181052009-181052031 AGGAGGCCAGAGGGTCGAGGGGG + Intronic
1002820583 6:720723-720745 AGGGGCATTAAGTGTCCAGGAGG + Intergenic
1002998208 6:2306403-2306425 AGGAGTCCAAAGTGTCCAGGTGG - Intergenic
1003432843 6:6055932-6055954 GGGATCACAAAGTGTCCTGGGGG + Intergenic
1003695669 6:8404525-8404547 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1003758835 6:9151726-9151748 AGAAGCCTAAAGTGTCCAGGTGG - Intergenic
1003763451 6:9208984-9209006 AAGAGCTCAAAGTGGCCAGTTGG - Intergenic
1004613667 6:17269359-17269381 AGGAGCTTGAAGTGCCCAGGTGG - Intergenic
1004945575 6:20609187-20609209 AGGTGCTCCAAGAGTCCAGGTGG - Intronic
1005225568 6:23638314-23638336 AGGAGCCCAAAATAGCCAGGTGG + Intergenic
1005853182 6:29838239-29838261 ATGAGGCCAAAGTGGCCAGAGGG - Intergenic
1006001774 6:30970704-30970726 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1006062562 6:31434833-31434855 AGGAGCCCAAAGTATCCAGGTGG - Intergenic
1006457489 6:34140291-34140313 AGGAGGCCAACGTGACCAGGGGG + Intronic
1006944575 6:37776972-37776994 AGGAGCCTGAGTTGTCCAGGTGG - Intergenic
1007983269 6:46180755-46180777 AGGAGTCCAAGATGGCCAGGTGG - Intergenic
1008079157 6:47176929-47176951 AGAAGCCCAAAGTGGCCAGGTGG + Intergenic
1008340476 6:50357915-50357937 AGGAGCTCTAAGTGTCCAGGTGG - Intergenic
1008400498 6:51057071-51057093 AGGAATCCAAAGTGTCCAGGTGG - Intergenic
1008810127 6:55486740-55486762 AGCAGCCCAAACTGACAAGGGGG - Intronic
1008820614 6:55626767-55626789 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1009389897 6:63133438-63133460 AGGAGCCCAAAGTGTCCAGATGG + Intergenic
1009469577 6:64016065-64016087 AGCAGCCCAAAGGTACCAGGTGG - Intronic
1009580232 6:65524259-65524281 AGGAGTCCAAAGTGGCCATATGG + Intronic
1009770146 6:68135215-68135237 AGGAGCCCAAAGTGGTCACAGGG + Intergenic
1009806705 6:68608584-68608606 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1010291917 6:74147404-74147426 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1010323790 6:74542122-74542144 GGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1010406797 6:75515263-75515285 AGGAGCCCAAAATGGCCAGGTGG + Intergenic
1010580588 6:77592606-77592628 AGAAGCCCAAAGTGTCCAGTTGG + Intergenic
1010853913 6:80813883-80813905 AGGAGTCCAAAGTGGCTGGGTGG + Intergenic
1010937969 6:81884295-81884317 AGGAACCCAACATGGCCAGGTGG + Intergenic
1011039129 6:83011670-83011692 AGGAGTCCAAAGTGTCCAAGTGG + Intronic
1011069325 6:83363289-83363311 AGGAGCCCAAAGTATCTAGGTGG - Intronic
1011830262 6:91363567-91363589 AGGAGCCCAAAGTGGCCATGTGG - Intergenic
1012002773 6:93674758-93674780 AGGAACCCAAAATGGCCAGGTGG - Intergenic
1012288604 6:97423262-97423284 AGGAGCCCAAAGTTTCCAGTTGG + Intergenic
1012344805 6:98171921-98171943 AGGATCCCAAAGTGTCCAGGTGG - Intergenic
1012747759 6:103116562-103116584 AGGATCCCAAAGTGGTCAGGTGG - Intergenic
1012821003 6:104084402-104084424 GGAAGCCCAAAGTGTTCAGGTGG - Intergenic
1013222096 6:108087246-108087268 GGGAGCCCAAAGTGGCCAGGTGG - Intronic
1013406888 6:109851376-109851398 AGGAGCCCAAAGTGTCCACGTGG - Intergenic
1013848949 6:114490485-114490507 TGGAGCTCAAAGTTTCCAGATGG + Intergenic
1014173519 6:118306159-118306181 AGGAGCCCAAAATGGCCAGGTGG + Intronic
1014363180 6:120506706-120506728 AGTAACCCAAAGTGTCCAAGTGG + Intergenic
1014417218 6:121197049-121197071 AGAAACCCAAAGTATCCAGGTGG - Intronic
1014455946 6:121635163-121635185 AGAAGCCCAAAGTGTCCAGGTGG - Intergenic
1014533966 6:122594962-122594984 AGGACCCCAAAGTGTCCAGGTGG + Intronic
1014631864 6:123798404-123798426 AAGAGCCCAAAGTGTCTACATGG - Intergenic
1014717062 6:124879233-124879255 ATGAGCCCAATGTGTCCACCTGG - Intergenic
1014895846 6:126898211-126898233 AGGAGCCCAAAGTGACCAGGTGG - Intergenic
1015443057 6:133270912-133270934 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1015473142 6:133629108-133629130 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1015475982 6:133659129-133659151 AGGAGCCCAAACTATCCAGGTGG - Intergenic
1015527453 6:134187234-134187256 AGGATCCCAAAGTGGCTGGGTGG + Intronic
1015584674 6:134763401-134763423 ACTTGCCCAAAGTTTCCAGGTGG + Intergenic
1015862257 6:137693108-137693130 AGGAGCCCAAAGTGGCCTAGTGG - Intergenic
1016119723 6:140331044-140331066 AGGACTCCAAAGTGTCCGGGTGG + Intergenic
1016147099 6:140691073-140691095 AGGATCCCAAAGTGTCCCAGTGG + Intergenic
1016157809 6:140834636-140834658 AGGAGCACAAAATGTCCAGGAGG - Intergenic
1016576044 6:145570948-145570970 AGGAGACCAAAGTGTCCAGGTGG + Intronic
1016594795 6:145787151-145787173 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
1017388361 6:153911514-153911536 AGGAGCCCAAAAAGTCCACGTGG + Intergenic
1017452556 6:154567306-154567328 AGGAGCCCAAAGTGGCTGGGTGG - Intergenic
1017558828 6:155604909-155604931 AGGAGCCCAAAGAGTACAGGTGG + Intergenic
1018534815 6:164808882-164808904 AGGAGCCCAAAGTGCCCAGGTGG + Intergenic
1018600109 6:165529136-165529158 AGGAGCCCAGAGTGTCCCTGTGG - Intronic
1018604579 6:165583984-165584006 AGGAGCCCAAAGTGACTGGGTGG - Intronic
1018780902 6:167064426-167064448 AGTAGCCCAAAGTGTCCAGGTGG + Intergenic
1019322503 7:422059-422081 AAGACCCCAAAGTGTACAGCTGG - Intergenic
1019463234 7:1172536-1172558 AGGAGCGCAAAGCCTCCTGGAGG - Intergenic
1020199904 7:6071571-6071593 AGGAACTGAAAGTGGCCAGGTGG + Intergenic
1020396882 7:7726777-7726799 AGGTGCCCAAAGGGTACAGCTGG - Intronic
1020870954 7:13628254-13628276 AGGAGGCCAAGGTTGCCAGGTGG + Intergenic
1021028856 7:15703963-15703985 AGTTGCCCAAAGTGTTAAGGAGG - Intergenic
1021989045 7:26124563-26124585 AGGATCCCAAAGTGTCCAGGTGG - Intergenic
1022898054 7:34772935-34772957 AAGAGTCCAAAGTGCCCTGGTGG + Intronic
1024293940 7:47828032-47828054 AGAAGCCCAGAGTCTCTAGGAGG - Intronic
1024610599 7:51060800-51060822 AGGAGCCCAGACTGACCATGTGG - Intronic
1024744435 7:52390065-52390087 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1024834672 7:53502476-53502498 AGTAGCCAAAAGTATCCAGGTGG - Intergenic
1024884135 7:54123022-54123044 AGGAGCCCAAAGTGTCCAAGTGG + Intergenic
1026046257 7:66907485-66907507 AGGACCCCAAAGTGTCCAGGTGG + Intergenic
1026995304 7:74612045-74612067 AGGAGCCCAAGGTGGGAAGGAGG + Intergenic
1027304097 7:76874466-76874488 AGTAGCCCAAAGTGTGGAGTAGG + Intergenic
1027406832 7:77871388-77871410 GGGAGCCCAAAGTGTCCAGGTGG + Intronic
1027474264 7:78609892-78609914 AGGAGCCCAAAGTTTCCAGGTGG + Intronic
1027546290 7:79531303-79531325 AGGAGCCCAAAGTGGCGGGGTGG + Intergenic
1027610340 7:80352289-80352311 AGGAGCCCAAGGTGTCCAGGTGG + Intergenic
1027742664 7:82031240-82031262 AGGAGCCTACAGTGGCAAGGAGG + Intronic
1028044060 7:86093101-86093123 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1028141956 7:87283655-87283677 AGGAGTCCGAAGTGTCAAGGTGG - Intergenic
1028238097 7:88384767-88384789 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1029333383 7:99878938-99878960 AGGAGCCCCAAGTGGCATGGTGG - Intronic
1029520634 7:101059511-101059533 AGGTGCTCAGAGTGTCCAGTAGG - Intergenic
1029919948 7:104252458-104252480 AGGAGCTTGAAGTGCCCAGGTGG - Intergenic
1030192532 7:106823870-106823892 AGGAGCCCAAAGTGACTGGGTGG + Intergenic
1030368983 7:108675682-108675704 AGGAGGTCAAAGTATCCAGGTGG - Intergenic
1030457235 7:109791425-109791447 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
1030506913 7:110436316-110436338 AGGAGCCCGAAGTGGCCAGGTGG - Intergenic
1030559294 7:111064714-111064736 AGGAGCCCAAGGTGTCCAGGTGG - Intronic
1030673817 7:112364730-112364752 AGGAGCCCAAGGTGCCCAGGTGG + Intergenic
1030728379 7:112953977-112953999 AGAAGCCCAACCTATCCAGGTGG - Intergenic
1030787108 7:113675593-113675615 AGAAGCCTAAAATGACCAGGTGG - Intergenic
1030883060 7:114904904-114904926 AGGAGCCCAAAGTGTCCGGGTGG + Intergenic
1031237082 7:119189899-119189921 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1031474226 7:122203719-122203741 AGGAGCTCAAAGTGTCCAGGTGG + Intergenic
1031676763 7:124619916-124619938 AGAAGCCCAAAGTATACAGGTGG - Intergenic
1031833236 7:126651656-126651678 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1031861297 7:126983095-126983117 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1032152870 7:129445336-129445358 AGGACCCCAAAGTGTCCAGGTGG + Intronic
1032443491 7:131960436-131960458 AGGGGCCCACAGTGTGCAGAAGG - Intergenic
1032584113 7:133130715-133130737 AGGATCCCAGAGTGATCAGGTGG - Intergenic
1032923258 7:136574503-136574525 AGGACCCCAAAGTGTCCAGGTGG + Intergenic
1033076486 7:138254654-138254676 AGGAGCCCAAAGTGTCCACGTGG - Intergenic
1033667159 7:143452391-143452413 AGGAGCTCAAAATGACCAGGTGG - Intergenic
1034170091 7:149056221-149056243 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1034275518 7:149822157-149822179 AGCAGCCCTGGGTGTCCAGGTGG - Intergenic
1034357046 7:150459313-150459335 AGGAGCCCAAAGTGGCCAGGTGG + Intronic
1034612778 7:152387057-152387079 AGGAGCCCAAAATGTTAAGTGGG + Intronic
1035185575 7:157123317-157123339 TGGAGCAGCAAGTGTCCAGGGGG - Intergenic
1036527071 8:9545177-9545199 AGGAGCTCAAAGTGGCTGGGTGG + Intergenic
1036658026 8:10690389-10690411 AGGAGCACAAAGGGGGCAGGGGG + Intronic
1037953872 8:23038011-23038033 AGGAACCCAAAGTGGCCAAGTGG - Intronic
1038454231 8:27662017-27662039 AGGAGCTCAAAGTGGCCAGGTGG + Intronic
1039323962 8:36464912-36464934 AGGAGCTCAAAGTGTCCAGGTGG + Intergenic
1039831560 8:41219354-41219376 AGGAGCCCAAAGTGTGTGTGTGG - Intergenic
1039873658 8:41567562-41567584 AGGAGCCCCAGGCATCCAGGGGG - Intergenic
1040793912 8:51268750-51268772 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
1041487256 8:58392654-58392676 AGCAGCCCAAGGGCTCCAGGAGG - Intergenic
1041986407 8:63926110-63926132 AGGAGCCAAAAGTGTCCAGGTGG - Intergenic
1042000836 8:64122358-64122380 AGGTGCCCAAAGTGTCCAGGTGG + Intergenic
1042342631 8:67696008-67696030 AGGAGCCCAAAGTGGCCAGGTGG - Intronic
1042958611 8:74278572-74278594 AGGAACCCAAAGTGTGCAGGTGG - Intronic
1043105504 8:76104791-76104813 AGGAACCCAAAGTGTCCAGGTGG + Intergenic
1043163932 8:76879813-76879835 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
1043258234 8:78161806-78161828 AGGAGCGGAAAGTGTCCAGGTGG - Intergenic
1043670672 8:82880965-82880987 AGGAGCCCACAGTGTGGGGGAGG - Intergenic
1044151015 8:88774710-88774732 AGGAGCCCAAAATGTCCAGGTGG - Intergenic
1044202615 8:89454113-89454135 AGGAGCCCAAAGTGTTCAGGTGG - Intergenic
1044486944 8:92765544-92765566 AGGAGCCCAAAGTTTCCAGGTGG + Intergenic
1044632919 8:94296773-94296795 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1044895847 8:96890683-96890705 CAGAGCCCAAAGTGTCCAGATGG + Intronic
1045221999 8:100208202-100208224 AGGAGCACAAAGTGTCCAGGTGG - Intronic
1045302260 8:100922050-100922072 AGGAGCACACAGTTTCCAAGAGG - Intronic
1045436103 8:102166278-102166300 AGGAGCACAAAGTGACTGGGCGG + Intergenic
1046128424 8:109939734-109939756 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1046197780 8:110885840-110885862 GAGAGCCCAAAGTGTCGAGGTGG - Intergenic
1046417432 8:113936166-113936188 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1046585557 8:116146097-116146119 AGGAGCCCAAAGTGTCAAGGTGG + Intergenic
1046941158 8:119932938-119932960 ATGAGACCAGAGTGTCCAGAGGG + Intronic
1048487227 8:134859629-134859651 AGGAGCTCAAAGATGCCAGGAGG + Intergenic
1048896261 8:138995138-138995160 AGGAGGCCACAGTGACCATGTGG + Intergenic
1048943342 8:139422178-139422200 AGGAGCTCAAAGTGTCCAGGTGG - Intergenic
1049538743 8:143195767-143195789 AGGGGCTCAAAGTGTCCAGGTGG - Intergenic
1050030702 9:1382344-1382366 AGCAGCCCAAAGTGACTGGGTGG - Intergenic
1050053110 9:1623541-1623563 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1050482901 9:6104233-6104255 AGGAGTCCAAAGTGTCCAGGTGG - Intergenic
1051082653 9:13311131-13311153 AGGTGCCCTAAGGGTTCAGGTGG - Intergenic
1051669494 9:19495363-19495385 ATCAGCCACAAGTGTCCAGGTGG + Intergenic
1051882180 9:21850907-21850929 AGGAGCCCAAAGTGTCCAGGTGG - Intronic
1052188357 9:25626597-25626619 AGGAGCCCAAAGCGTCCATGTGG - Intergenic
1052227803 9:26110016-26110038 AGGAGCCCAAAGTGTCCAGGTGG - Exonic
1052561348 9:30088359-30088381 AGAAGCCCAAAGTGTCCAGGTGG + Intergenic
1052737108 9:32353931-32353953 AGGTGCCCCAAGTGTCCAGGTGG + Intergenic
1052895299 9:33741980-33742002 AGGATCCCAAAGTGGCCAGGTGG + Intergenic
1053594823 9:39549049-39549071 AGGAGCCCAGAGCCTGCAGGAGG + Intergenic
1053695736 9:40637873-40637895 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1053852608 9:42304082-42304104 AGGAGCCCAGAGCCTGCAGGAGG + Intergenic
1054306983 9:63437091-63437113 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1054405714 9:64761079-64761101 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1054439341 9:65246566-65246588 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1054491066 9:65775373-65775395 AGGACCCCAAAGCATCCAAGTGG - Intergenic
1054571430 9:66815918-66815940 AGGAGCCCAGAGCCTGCAGGAGG - Intergenic
1055103330 9:72487347-72487369 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1055732360 9:79291557-79291579 AGAAGCTCAAAATGGCCAGGTGG + Intergenic
1056156905 9:83846841-83846863 TGGAGCCCAAAGTGTCCAGGTGG - Intronic
1056314014 9:85371298-85371320 AGGAGCCCACAGTGTCCAGGTGG + Intergenic
1056353634 9:85776685-85776707 TAGAGCCCAAAGTGTCCAGGTGG + Intergenic
1057004726 9:91547166-91547188 AGGAGCCCAAAGTGGCTGGGAGG + Intergenic
1057013911 9:91633283-91633305 AGCAGCCCAAAGTGCCCATGTGG - Intronic
1057100372 9:92353623-92353645 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1057720154 9:97525795-97525817 AGGAGCCCAAAGTGGCCTGGTGG + Intronic
1058020125 9:100077682-100077704 AGGAGTTCAAAGTGTCCAGCTGG - Intronic
1058124796 9:101178999-101179021 AGAAGCCCAAAGTTTCCAGGTGG - Intronic
1058259043 9:102808074-102808096 AGAAACCCAAAATATCCAGGTGG + Intergenic
1058543955 9:106041118-106041140 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1059196282 9:112374228-112374250 AGGAGCACAAAATGTCCAGGTGG + Intergenic
1061092322 9:128433660-128433682 AGGAGGCCAAAGTGACAAGCTGG + Intronic
1061311809 9:129768410-129768432 AGGAGCCCAAAGTGGCCGGGTGG + Intergenic
1061523403 9:131136929-131136951 TGGAGCACAAAGTATCCATGTGG - Intronic
1061645299 9:131996101-131996123 AGGAGCCCAAAGTGCCCAGGTGG - Intronic
1062069517 9:134548011-134548033 AGGAGCCCACAGTGAGCAAGAGG + Intergenic
1062501220 9:136852824-136852846 AGGAACCCAGAGTGCCCAGCAGG - Intronic
1062502329 9:136856900-136856922 AGGAGCACAAAGTGGCCTGCAGG - Exonic
1062724044 9:138061241-138061263 AGCAGCCCCAAGTGACCAGGTGG + Intronic
1062729518 9:138101329-138101351 AGGGAACCAAAGCGTCCAGGAGG - Intronic
1202778181 9_KI270717v1_random:11485-11507 AGGACCCCAAAGCATCCAAGTGG + Intergenic
1186469532 X:9810499-9810521 AGGAGCCCAAAGCACCCAGGTGG + Intronic
1187524136 X:20038742-20038764 AGGAGCTTAAAGTGTCCAGGGGG - Intronic
1190155218 X:47985868-47985890 AGGAGCCCAAAGTAGCCAGGTGG - Intronic
1190527654 X:51344269-51344291 AGGATCCCAAAGTGGCCAGGTGG + Intergenic
1190996379 X:55614468-55614490 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1190996533 X:55615850-55615872 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1191095502 X:56669554-56669576 AAGAGCCCACAGTGGCCAGGTGG + Intergenic
1191629800 X:63310955-63310977 AGGAGCCCAAAGTGTCCATGTGG + Intergenic
1191719024 X:64214083-64214105 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1191759572 X:64631532-64631554 AGGAGCTCAAAGTGTCCAGGTGG - Intergenic
1191769282 X:64738458-64738480 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1191880072 X:65837030-65837052 AAGAGACCATAGTGTCCAGTTGG - Intergenic
1191933130 X:66395786-66395808 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1191941043 X:66482254-66482276 AAGACCCCAAAGTGCCCAGGTGG + Intergenic
1191988151 X:67004226-67004248 AGAAACCCAAAGTGGCCAGGTGG + Intergenic
1192297487 X:69866385-69866407 AGGAGCCTAAAGTGTCCAGGTGG + Intronic
1192358932 X:70426324-70426346 ATGAGCCCAAATTGACCAAGAGG + Intronic
1192661361 X:73046155-73046177 AGGAACCCAAAGTGGATAGGTGG + Intergenic
1192673039 X:73166771-73166793 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1192891252 X:75393212-75393234 AGGAGCCCAAAATGTTCAGGTGG + Intronic
1192898922 X:75473528-75473550 AGGAGCCCAAACTGTCCAGGTGG - Intronic
1192996397 X:76517215-76517237 AGGGGCCCAAAGTGGCCAGGTGG - Intergenic
1193053715 X:77127401-77127423 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1193288150 X:79737846-79737868 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1193297988 X:79854291-79854313 AGGAGCCCAAAGTGTTCTAGTGG - Intergenic
1193356465 X:80524776-80524798 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1193435300 X:81468098-81468120 AGGAGTCTAAAGAATCCAGGTGG + Intergenic
1193447387 X:81620401-81620423 AGGAGCCCAAAGTGGCCAGGTGG - Intergenic
1193573492 X:83173543-83173565 AGGAGCCCTAAGTGTAGAGGTGG + Intergenic
1193841332 X:86412132-86412154 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1193904689 X:87227458-87227480 AGGAGCTCAAAGTGTCCCGGTGG - Intergenic
1193905466 X:87238289-87238311 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1193914598 X:87350317-87350339 AGGAGCCCAAAGTGGTCAGATGG + Intergenic
1193979103 X:88159055-88159077 AGGACCCCAAAGTTACCAGGTGG - Intergenic
1193984420 X:88222603-88222625 AGGAGGCTAATGTGGCCAGGTGG - Intergenic
1194072110 X:89338947-89338969 AGGAGCCCAAATTAGCTAGGTGG + Intergenic
1194140628 X:90204543-90204565 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
1194155170 X:90379328-90379350 AAGAGCCCTAAGAGGCCAGGTGG + Intergenic
1194174842 X:90632464-90632486 GGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1194179383 X:90694297-90694319 AGAAGTGCAAAGTGTCCAGGTGG + Intergenic
1194210505 X:91063982-91064004 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1194233073 X:91347918-91347940 AGGAGCTCAAAGTGGCCAGGTGG - Intergenic
1194343527 X:92732719-92732741 AGGATCCCAAAGTGGCCAAGTGG - Intergenic
1194485322 X:94478927-94478949 AGGAGCCCAAAGTGTCTAGGAGG - Intergenic
1194513208 X:94820631-94820653 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1194521266 X:94921087-94921109 AGAAGCCCAAAGTGGCTAGGTGG - Intergenic
1194538639 X:95141982-95142004 AGGAGCCCAATGTGGCCAGGTGG + Intergenic
1194584340 X:95714698-95714720 AGGAGCCCAAAGTTTCCAGGTGG - Intergenic
1194626784 X:96234620-96234642 AGGAGTACAAAGTGGCCAGGTGG - Intergenic
1194834168 X:98660435-98660457 AGCAGCCCAAAGTGTCCACGTGG - Intergenic
1195013421 X:100755112-100755134 AGGAGCCCAAAGTGGTCAGGTGG + Intergenic
1195097152 X:101514092-101514114 AGAAGCCCAAAGTGGCCTGGTGG + Intronic
1195544943 X:106103695-106103717 AATAGTCCAAAGTGGCCAGGTGG - Intergenic
1195748688 X:108143610-108143632 AGGAGCCCAAAGTGTCCAGGTGG + Intronic
1195782122 X:108478237-108478259 AGGGGCCCAAAGTGTCCAGGTGG + Intronic
1196125558 X:112095154-112095176 AGGAGCAAAAAGTATCCACGTGG + Intergenic
1196372453 X:114994947-114994969 AGGATCCCAAAGTGTCAAGGTGG + Intergenic
1196605332 X:117651227-117651249 AGGAGCCCAAAGTATCCAGGTGG - Intergenic
1197002511 X:121454551-121454573 AGGCACCCAAAGGGTCCAGGTGG - Intergenic
1197062647 X:122199605-122199627 AGGAGCCAAAGGTGGCCAGGGGG + Intergenic
1197074221 X:122336238-122336260 AGGAGCCCAAAGTGGCCAAGTGG + Intergenic
1197182323 X:123549413-123549435 AGGAGCCCAAAGTGTCTGGGTGG - Intergenic
1197228514 X:123978081-123978103 GGGAGGCCAAAGCGGCCAGGTGG - Intronic
1197244823 X:124157362-124157384 AGGAGCCCTAAGTGTCCGGGTGG + Intronic
1197371833 X:125636230-125636252 AGGAGCCTAAAGTGGCCAGGTGG + Intergenic
1197405384 X:126041833-126041855 AGGTGCCCAAAGTGTCCAGGTGG - Intergenic
1197409119 X:126094827-126094849 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1197420105 X:126227969-126227991 AGGAGCCCAAAGTGTCCAGGTGG - Intergenic
1197522151 X:127511924-127511946 AGTAGCCCAAAGTGACCAGGTGG - Intergenic
1197592095 X:128421024-128421046 AGGAGCCCAAAGTGTGCAGGTGG - Intergenic
1198170263 X:134098348-134098370 AGGAGCCCAAAGTGGCCAGGCGG - Intergenic
1198307094 X:135394095-135394117 AGGAGCCCAAAGCGTCCAGGTGG - Intergenic
1198412274 X:136382801-136382823 AGGAACCCAAAGTGTCCAGGTGG + Intronic
1198482176 X:137051538-137051560 AGGAACGAAAAGTGTCCAGTTGG - Intergenic
1198701523 X:139401934-139401956 GGGAGCCCAAAGTGTCCACGTGG - Intergenic
1198703082 X:139418021-139418043 AGAAGTCCAAAGTGCCCAGGTGG - Intergenic
1199013337 X:142782301-142782323 AGGAGCCCAAAGTGTCTGGGGGG - Intergenic
1199024597 X:142921362-142921384 AGGAGCCCAAAGTGTCCACGCGG - Intergenic
1199116351 X:143997633-143997655 AGGAGCCCAATGTGTCCAGGTGG + Intergenic
1199144238 X:144347336-144347358 AGAAGCCCAAAGTGTCCAGGTGG + Intergenic
1199616842 X:149662773-149662795 AGAAGCTCAAAGTGCCCAGATGG + Intergenic
1199625799 X:149740475-149740497 AGAAGCTCAAAGTGCCCAGATGG - Intergenic
1200010086 X:153114272-153114294 AGGAGCCCACAGTCTCCCAGAGG - Intergenic
1200029514 X:153285650-153285672 AGGAGCCCACAGTCTCCCAGAGG + Intergenic
1200278742 X:154758831-154758853 AGGAGCCAGAAGTGGCCAAGTGG - Intergenic
1200486394 Y:3773669-3773691 AGGAGCCCAAAGTGGCCAGGTGG + Intergenic
1200501521 Y:3956264-3956286 AAGAGCCCTAAGAGGCCAGGTGG + Intergenic
1200521491 Y:4213654-4213676 GGGAGCCCAGAGTGTCCAGGTGG - Intergenic
1200526049 Y:4276470-4276492 AGAAGTGCAAAGTGTCCAGGTGG + Intergenic
1200651882 Y:5849384-5849406 AGGATCCCAAAGTGGCCAAGTGG - Intergenic
1200690947 Y:6306085-6306107 AGGAGGGCACAGTGTTCAGGCGG + Intergenic
1200726355 Y:6674698-6674720 AGGAGCCCAAATTAGCTAGGTGG + Intergenic
1200745831 Y:6903237-6903259 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1201044325 Y:9868631-9868653 AGGAGGGCACAGTGTTCAGGCGG - Intergenic
1201529449 Y:14976270-14976292 AGGAGCCCAAAGTGTCCAGGTGG + Intergenic
1202134401 Y:21646782-21646804 AGGAGCCCAAAGTGATAAGGGGG + Intergenic
1202357857 Y:24071061-24071083 AGGAGGCCCAAGTGTCCAGGTGG + Intergenic
1202512921 Y:25599052-25599074 AGGAGGCCCAAGTGTCCAGGTGG - Intergenic