ID: 1191769493

View in Genome Browser
Species Human (GRCh38)
Location X:64740090-64740112
Sequence ACAGCTTTTGGCCTGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769493_1191769500 16 Left 1191769493 X:64740090-64740112 CCCAGTAACAGGCCAAAAGCTGT No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769493_1191769501 17 Left 1191769493 X:64740090-64740112 CCCAGTAACAGGCCAAAAGCTGT No data
Right 1191769501 X:64740130-64740152 GTTATTTGCAGAAGAAGGCAGGG No data
1191769493_1191769499 12 Left 1191769493 X:64740090-64740112 CCCAGTAACAGGCCAAAAGCTGT No data
Right 1191769499 X:64740125-64740147 GAGTAGTTATTTGCAGAAGAAGG 0: 11
1: 189
2: 190
3: 139
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769493 Original CRISPR ACAGCTTTTGGCCTGTTACT GGG (reversed) Intergenic
No off target data available for this crispr