ID: 1191769494

View in Genome Browser
Species Human (GRCh38)
Location X:64740091-64740113
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769494_1191769501 16 Left 1191769494 X:64740091-64740113 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1191769501 X:64740130-64740152 GTTATTTGCAGAAGAAGGCAGGG No data
1191769494_1191769499 11 Left 1191769494 X:64740091-64740113 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1191769499 X:64740125-64740147 GAGTAGTTATTTGCAGAAGAAGG 0: 11
1: 189
2: 190
3: 139
4: 322
1191769494_1191769500 15 Left 1191769494 X:64740091-64740113 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769494 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr