ID: 1191769496

View in Genome Browser
Species Human (GRCh38)
Location X:64740102-64740124
Sequence TCCTTTTGAGGGACAGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769496_1191769500 4 Left 1191769496 X:64740102-64740124 CCAAAAGCTGTCCCTCAAAAGGA No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769496_1191769501 5 Left 1191769496 X:64740102-64740124 CCAAAAGCTGTCCCTCAAAAGGA No data
Right 1191769501 X:64740130-64740152 GTTATTTGCAGAAGAAGGCAGGG No data
1191769496_1191769499 0 Left 1191769496 X:64740102-64740124 CCAAAAGCTGTCCCTCAAAAGGA No data
Right 1191769499 X:64740125-64740147 GAGTAGTTATTTGCAGAAGAAGG 0: 11
1: 189
2: 190
3: 139
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769496 Original CRISPR TCCTTTTGAGGGACAGCTTT TGG (reversed) Intergenic
No off target data available for this crispr