ID: 1191769497

View in Genome Browser
Species Human (GRCh38)
Location X:64740113-64740135
Sequence AATAACTACTCTCCTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769497_1191769500 -7 Left 1191769497 X:64740113-64740135 CCCTCAAAAGGAGAGTAGTTATT No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769497_1191769504 25 Left 1191769497 X:64740113-64740135 CCCTCAAAAGGAGAGTAGTTATT No data
Right 1191769504 X:64740161-64740183 CAAAATCCTAGAACCCTCCGTGG No data
1191769497_1191769501 -6 Left 1191769497 X:64740113-64740135 CCCTCAAAAGGAGAGTAGTTATT No data
Right 1191769501 X:64740130-64740152 GTTATTTGCAGAAGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769497 Original CRISPR AATAACTACTCTCCTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr