ID: 1191769500

View in Genome Browser
Species Human (GRCh38)
Location X:64740129-64740151
Sequence AGTTATTTGCAGAAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191769496_1191769500 4 Left 1191769496 X:64740102-64740124 CCAAAAGCTGTCCCTCAAAAGGA No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769497_1191769500 -7 Left 1191769497 X:64740113-64740135 CCCTCAAAAGGAGAGTAGTTATT No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769492_1191769500 25 Left 1191769492 X:64740081-64740103 CCACTAAAGCCCAGTAACAGGCC 0: 7
1: 155
2: 166
3: 94
4: 178
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769498_1191769500 -8 Left 1191769498 X:64740114-64740136 CCTCAAAAGGAGAGTAGTTATTT No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769494_1191769500 15 Left 1191769494 X:64740091-64740113 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data
1191769493_1191769500 16 Left 1191769493 X:64740090-64740112 CCCAGTAACAGGCCAAAAGCTGT No data
Right 1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191769500 Original CRISPR AGTTATTTGCAGAAGAAGGC AGG Intergenic
No off target data available for this crispr