ID: 1191776450

View in Genome Browser
Species Human (GRCh38)
Location X:64819762-64819784
Sequence TCACCCTTCCCAATAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191776450_1191776455 -4 Left 1191776450 X:64819762-64819784 CCAGGGCCTATTGGGAAGGGTGA No data
Right 1191776455 X:64819781-64819803 GTGAGGCAAGGGAGAGCATCAGG No data
1191776450_1191776457 25 Left 1191776450 X:64819762-64819784 CCAGGGCCTATTGGGAAGGGTGA No data
Right 1191776457 X:64819810-64819832 AGTCCATTGTCAATTCATATGGG No data
1191776450_1191776456 24 Left 1191776450 X:64819762-64819784 CCAGGGCCTATTGGGAAGGGTGA No data
Right 1191776456 X:64819809-64819831 TAGTCCATTGTCAATTCATATGG No data
1191776450_1191776458 26 Left 1191776450 X:64819762-64819784 CCAGGGCCTATTGGGAAGGGTGA No data
Right 1191776458 X:64819811-64819833 GTCCATTGTCAATTCATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191776450 Original CRISPR TCACCCTTCCCAATAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr