ID: 1191783748

View in Genome Browser
Species Human (GRCh38)
Location X:64895422-64895444
Sequence AGGATCTAGGTGGGAATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191783748_1191783752 -4 Left 1191783748 X:64895422-64895444 CCATATATTCCCACCTAGATCCT No data
Right 1191783752 X:64895441-64895463 TCCTACAATTAGCATTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191783748 Original CRISPR AGGATCTAGGTGGGAATATA TGG (reversed) Intergenic
No off target data available for this crispr