ID: 1191784348

View in Genome Browser
Species Human (GRCh38)
Location X:64901660-64901682
Sequence ACTCATAAACTTAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784348_1191784352 20 Left 1191784348 X:64901660-64901682 CCCTTTACCTTAAGTTTATGAGT No data
Right 1191784352 X:64901703-64901725 TCTTGAAGACAGCAGATACTTGG 0: 128
1: 271
2: 470
3: 835
4: 1680
1191784348_1191784353 24 Left 1191784348 X:64901660-64901682 CCCTTTACCTTAAGTTTATGAGT No data
Right 1191784353 X:64901707-64901729 GAAGACAGCAGATACTTGGTTGG 0: 111
1: 283
2: 408
3: 366
4: 380
1191784348_1191784354 27 Left 1191784348 X:64901660-64901682 CCCTTTACCTTAAGTTTATGAGT No data
Right 1191784354 X:64901710-64901732 GACAGCAGATACTTGGTTGGTGG 0: 42
1: 60
2: 77
3: 59
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784348 Original CRISPR ACTCATAAACTTAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr