ID: 1191784348 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:64901660-64901682 |
Sequence | ACTCATAAACTTAAGGTAAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1191784348_1191784352 | 20 | Left | 1191784348 | X:64901660-64901682 | CCCTTTACCTTAAGTTTATGAGT | No data | ||
Right | 1191784352 | X:64901703-64901725 | TCTTGAAGACAGCAGATACTTGG | 0: 128 1: 271 2: 470 3: 835 4: 1680 |
||||
1191784348_1191784353 | 24 | Left | 1191784348 | X:64901660-64901682 | CCCTTTACCTTAAGTTTATGAGT | No data | ||
Right | 1191784353 | X:64901707-64901729 | GAAGACAGCAGATACTTGGTTGG | 0: 111 1: 283 2: 408 3: 366 4: 380 |
||||
1191784348_1191784354 | 27 | Left | 1191784348 | X:64901660-64901682 | CCCTTTACCTTAAGTTTATGAGT | No data | ||
Right | 1191784354 | X:64901710-64901732 | GACAGCAGATACTTGGTTGGTGG | 0: 42 1: 60 2: 77 3: 59 4: 155 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1191784348 | Original CRISPR | ACTCATAAACTTAAGGTAAA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |