ID: 1191784585

View in Genome Browser
Species Human (GRCh38)
Location X:64903743-64903765
Sequence CCTGGAGCCTGTGCTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784585_1191784600 28 Left 1191784585 X:64903743-64903765 CCTCTGCCAGCACAGGCTCCAGG No data
Right 1191784600 X:64903794-64903816 ATATAACCAACTTCTATGTGGGG No data
1191784585_1191784591 2 Left 1191784585 X:64903743-64903765 CCTCTGCCAGCACAGGCTCCAGG No data
Right 1191784591 X:64903768-64903790 TGGATTTCCCTCCCCTATACTGG No data
1191784585_1191784599 27 Left 1191784585 X:64903743-64903765 CCTCTGCCAGCACAGGCTCCAGG No data
Right 1191784599 X:64903793-64903815 AATATAACCAACTTCTATGTGGG No data
1191784585_1191784598 26 Left 1191784585 X:64903743-64903765 CCTCTGCCAGCACAGGCTCCAGG No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784585 Original CRISPR CCTGGAGCCTGTGCTGGCAG AGG (reversed) Intergenic
No off target data available for this crispr