ID: 1191784589

View in Genome Browser
Species Human (GRCh38)
Location X:64903761-64903783
Sequence AGGGGAGGGAAATCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784589_1191784600 10 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784600 X:64903794-64903816 ATATAACCAACTTCTATGTGGGG No data
1191784589_1191784602 21 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784589_1191784598 8 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784589_1191784599 9 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784599 X:64903793-64903815 AATATAACCAACTTCTATGTGGG No data
1191784589_1191784603 22 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784589 Original CRISPR AGGGGAGGGAAATCCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr