ID: 1191784594

View in Genome Browser
Species Human (GRCh38)
Location X:64903779-64903801
Sequence GGTTATATTGGCCAGTATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784594_1191784599 -9 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784599 X:64903793-64903815 AATATAACCAACTTCTATGTGGG No data
1191784594_1191784602 3 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784594_1191784603 4 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784594_1191784600 -8 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784600 X:64903794-64903816 ATATAACCAACTTCTATGTGGGG No data
1191784594_1191784598 -10 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784594 Original CRISPR GGTTATATTGGCCAGTATAG GGG (reversed) Intergenic
No off target data available for this crispr