ID: 1191784598

View in Genome Browser
Species Human (GRCh38)
Location X:64903792-64903814
Sequence CAATATAACCAACTTCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784593_1191784598 -7 Left 1191784593 X:64903776-64903798 CCTCCCCTATACTGGCCAATATA No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784588_1191784598 20 Left 1191784588 X:64903749-64903771 CCAGCACAGGCTCCAGGCCTGGA No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784584_1191784598 27 Left 1191784584 X:64903742-64903764 CCCTCTGCCAGCACAGGCTCCAG No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784590_1191784598 3 Left 1191784590 X:64903766-64903788 CCTGGATTTCCCTCCCCTATACT No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784581_1191784598 30 Left 1191784581 X:64903739-64903761 CCCCCCTCTGCCAGCACAGGCTC No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784583_1191784598 28 Left 1191784583 X:64903741-64903763 CCCCTCTGCCAGCACAGGCTCCA No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784592_1191784598 -6 Left 1191784592 X:64903775-64903797 CCCTCCCCTATACTGGCCAATAT No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784594_1191784598 -10 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784582_1191784598 29 Left 1191784582 X:64903740-64903762 CCCCCTCTGCCAGCACAGGCTCC No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784585_1191784598 26 Left 1191784585 X:64903743-64903765 CCTCTGCCAGCACAGGCTCCAGG No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data
1191784589_1191784598 8 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784598 X:64903792-64903814 CAATATAACCAACTTCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784598 Original CRISPR CAATATAACCAACTTCTATG TGG Intergenic
No off target data available for this crispr