ID: 1191784602

View in Genome Browser
Species Human (GRCh38)
Location X:64903805-64903827
Sequence TTCTATGTGGGGTGATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784595_1191784602 2 Left 1191784595 X:64903780-64903802 CCCTATACTGGCCAATATAACCA No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784593_1191784602 6 Left 1191784593 X:64903776-64903798 CCTCCCCTATACTGGCCAATATA No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784596_1191784602 1 Left 1191784596 X:64903781-64903803 CCTATACTGGCCAATATAACCAA No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784592_1191784602 7 Left 1191784592 X:64903775-64903797 CCCTCCCCTATACTGGCCAATAT No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784589_1191784602 21 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784597_1191784602 -9 Left 1191784597 X:64903791-64903813 CCAATATAACCAACTTCTATGTG No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784590_1191784602 16 Left 1191784590 X:64903766-64903788 CCTGGATTTCCCTCCCCTATACT No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data
1191784594_1191784602 3 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784602 X:64903805-64903827 TTCTATGTGGGGTGATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784602 Original CRISPR TTCTATGTGGGGTGATTTCT AGG Intergenic
No off target data available for this crispr