ID: 1191784603

View in Genome Browser
Species Human (GRCh38)
Location X:64903806-64903828
Sequence TCTATGTGGGGTGATTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191784594_1191784603 4 Left 1191784594 X:64903779-64903801 CCCCTATACTGGCCAATATAACC No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784593_1191784603 7 Left 1191784593 X:64903776-64903798 CCTCCCCTATACTGGCCAATATA No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784590_1191784603 17 Left 1191784590 X:64903766-64903788 CCTGGATTTCCCTCCCCTATACT No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784592_1191784603 8 Left 1191784592 X:64903775-64903797 CCCTCCCCTATACTGGCCAATAT No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784596_1191784603 2 Left 1191784596 X:64903781-64903803 CCTATACTGGCCAATATAACCAA No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784589_1191784603 22 Left 1191784589 X:64903761-64903783 CCAGGCCTGGATTTCCCTCCCCT No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784595_1191784603 3 Left 1191784595 X:64903780-64903802 CCCTATACTGGCCAATATAACCA No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data
1191784597_1191784603 -8 Left 1191784597 X:64903791-64903813 CCAATATAACCAACTTCTATGTG No data
Right 1191784603 X:64903806-64903828 TCTATGTGGGGTGATTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191784603 Original CRISPR TCTATGTGGGGTGATTTCTA GGG Intergenic
No off target data available for this crispr