ID: 1191786340

View in Genome Browser
Species Human (GRCh38)
Location X:64920689-64920711
Sequence ACTTAGGGCTTCCGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191786336_1191786340 16 Left 1191786336 X:64920650-64920672 CCTGGGGAAATACTTCTTAGTAT 0: 1
1: 0
2: 3
3: 11
4: 143
Right 1191786340 X:64920689-64920711 ACTTAGGGCTTCCGCCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191786340 Original CRISPR ACTTAGGGCTTCCGCCTCCC AGG Intronic
900240814 1:1616367-1616389 ACTCAGGGCCGCCGCCTGCCCGG - Intronic
900918890 1:5658479-5658501 GCTCAGGGCTCCTGCCTCCCAGG - Intergenic
901435993 1:9247717-9247739 ACGCAGGGCCCCCGCCTCCCGGG - Intronic
902781817 1:18709841-18709863 ACTTAGGACCTCAGCTTCCCTGG - Intronic
903472230 1:23595246-23595268 ACTTGGGGCCTCCTGCTCCCAGG + Intronic
903670707 1:25033915-25033937 CCTACGGGCTTCCTCCTCCCTGG - Intergenic
916210549 1:162356515-162356537 CCTTAGGGCTCCCTCCTCCAGGG - Intronic
916418647 1:164615875-164615897 ACTTTGGGATTTGGCCTCCCTGG + Intronic
916591288 1:166193349-166193371 ACTTAAGGCTTCCTTCTCTCTGG + Intergenic
916763500 1:167838073-167838095 ACTTAGGTTTTCTGGCTCCCAGG + Intronic
917287547 1:173436905-173436927 ACTTAGGGCTTTTGGCTACCGGG + Intergenic
918495159 1:185127026-185127048 ACTTAGGTTTTCTGACTCCCAGG - Intronic
919901776 1:202049063-202049085 ACAGAGGGCTTCAGCCTTCCAGG - Intergenic
920501778 1:206490213-206490235 TCTTGGGGCTGCCGCCACCCTGG + Intronic
920747591 1:208643556-208643578 ATTGAGGGATTCCACCTCCCTGG + Intergenic
924081238 1:240400533-240400555 ACTGTGGGCTTCCACCTGCCCGG + Intronic
1067773172 10:49142066-49142088 ACCAGGGGCTTCCCCCTCCCCGG + Intergenic
1071272022 10:84016684-84016706 CTTTAGGGCTTCCTCCTCCCTGG - Intergenic
1071955628 10:90756187-90756209 GCTTAGGACTTCCTCTTCCCCGG - Intronic
1074415124 10:113260954-113260976 ACTGTGGGCTCCCTCCTCCCTGG - Intergenic
1082284210 11:50301861-50301883 ACATTGGGCTTCCCTCTCCCAGG + Intergenic
1082819336 11:57533476-57533498 ACTTCTGCCTCCCGCCTCCCGGG - Intergenic
1083562236 11:63681884-63681906 ACTGACGGCTTCAGCCCCCCGGG + Intronic
1083632197 11:64101569-64101591 AGTGAGGTCATCCGCCTCCCTGG - Intronic
1083650280 11:64199637-64199659 ACTGCAAGCTTCCGCCTCCCGGG + Intronic
1083709753 11:64540801-64540823 ACTTCGTGCTTCAGCTTCCCTGG - Intergenic
1084866686 11:72063845-72063867 TATTATGGCTTCAGCCTCCCAGG - Intronic
1090190371 11:124762678-124762700 ACTTGGGGGTGCCGCATCCCCGG + Intergenic
1091798670 12:3311140-3311162 ACTCAGGGCCTCCCCCACCCAGG - Intergenic
1093099387 12:15009505-15009527 ACTTTGGACTTCCACCTTCCTGG - Intergenic
1096362295 12:50998281-50998303 ACTTGCAGCCTCCGCCTCCCAGG - Intronic
1099884278 12:88508109-88508131 CATTACGACTTCCGCCTCCCGGG - Intronic
1102245565 12:111353645-111353667 CCTTTGGGCTTCTTCCTCCCGGG - Intergenic
1103084838 12:118054592-118054614 ACCTCTGCCTTCCGCCTCCCGGG - Intronic
1104934242 12:132356013-132356035 ACTGAGGGCTGCCGCCTCTGTGG - Intergenic
1109073811 13:57806595-57806617 AGTGATGGCTTCCACCTCCCTGG + Intergenic
1112449515 13:99496116-99496138 ACTTTGGGCTTCCTCCTACCTGG + Intergenic
1113455225 13:110443915-110443937 ACTTAGGGTTCCCGCCTATCTGG + Intronic
1113906870 13:113823354-113823376 AGGTAGGGCCTCCGCCACCCAGG - Exonic
1114557114 14:23568366-23568388 TCCTAGGGCTTCCTGCTCCCAGG + Exonic
1114758632 14:25286626-25286648 ACTCAGGGATTCTGCCTCCCCGG - Intergenic
1121335969 14:93077677-93077699 ACACAGGGCTTTCTCCTCCCTGG + Intronic
1123129323 14:105972928-105972950 ACTTAGGGCTTCCAGGTCACAGG - Intergenic
1123409835 15:20049094-20049116 ACTTAGGGCTTCCAGGTCACAGG - Intergenic
1123519167 15:21055802-21055824 ACTTAGGGCTTCCAGGTCACAGG - Intergenic
1128432412 15:67609853-67609875 TCTTAGGGCTTCCGCCTGAGTGG - Intronic
1129782648 15:78283825-78283847 TCTTATGGCTTCCGTCTTCCTGG - Intronic
1130260279 15:82348978-82349000 TCTTTGGGCTTGCGTCTCCCAGG - Intronic
1130268451 15:82430455-82430477 TCTTTGGGCTTGCGTCTCCCAGG + Intronic
1130280954 15:82520029-82520051 TCTTTGGGCTTGCGTCTCCCAGG + Intergenic
1130472324 15:84236210-84236232 TCTTTGGGCTTGCGTCTCCCAGG + Intronic
1130479815 15:84350781-84350803 TCTTTGGGCTTGCGTCTCCCAGG + Intergenic
1130491955 15:84437348-84437370 TCTTTGGGCTTGCGTCTCCCAGG - Intergenic
1130503569 15:84516388-84516410 TCTTTGGGCTTGCGTCTCCCAGG - Intergenic
1130594622 15:85240846-85240868 TCTTTGGGCTTGCGTCTCCCAGG + Intergenic
1132514061 16:358123-358145 ACTTTGGGCTGGGGCCTCCCCGG + Intergenic
1132674012 16:1114231-1114253 ACTTTGGGCTTCCGCCCCCCAGG - Intergenic
1132785740 16:1656241-1656263 GCTTAGGGCAGCCCCCTCCCCGG - Exonic
1134102893 16:11464961-11464983 ACATAGGTCTTCCCCCACCCAGG + Intronic
1135334103 16:21586343-21586365 ACTTCTGCCCTCCGCCTCCCAGG - Intergenic
1135435956 16:22426880-22426902 ACTCACAACTTCCGCCTCCCAGG + Intronic
1135924860 16:26684726-26684748 ACTTGCAACTTCCGCCTCCCAGG + Intergenic
1138274607 16:55724725-55724747 ACTTAGGGGGTCAGACTCCCTGG - Intergenic
1140542183 16:75766837-75766859 CCTTAGGGCTACTCCCTCCCTGG - Intergenic
1142045163 16:87920692-87920714 ACTTACAACTTCCGCCTCCCAGG + Intronic
1142558953 17:798705-798727 ACTTAGGGCAACCCCCTCGCTGG + Intergenic
1144025663 17:11274097-11274119 CCTTAGGGCTTCGTCCTGCCTGG + Intronic
1147554014 17:41464816-41464838 AGTTAGGGCAGCTGCCTCCCAGG + Intronic
1149656737 17:58313533-58313555 ACTTCTAGCTTCTGCCTCCCGGG - Intronic
1150251229 17:63705858-63705880 ACTCAAGGCTGCCTCCTCCCAGG + Intronic
1158096522 18:53778388-53778410 GCTCATGGCATCCGCCTCCCAGG - Intergenic
1160967556 19:1753339-1753361 ACTTGGGGCTTCGGCGTCCCTGG - Exonic
1161059131 19:2206071-2206093 ACTTGCAGCTTCCACCTCCCAGG + Intronic
1162035234 19:7934839-7934861 ACTTACTGCTGCCGACTCCCTGG + Intronic
1162567330 19:11451637-11451659 ACTTGGGGCTTCCACGTCCCTGG - Exonic
1162770894 19:12948817-12948839 AGGTGGGGCTTCCGCCTCCCGGG + Intronic
1165285598 19:34839141-34839163 GCTTCGGGATTCCGCCTACCCGG + Intergenic
1165729098 19:38132990-38133012 CCTTAGAGCTTCCCCCTTCCTGG + Intronic
1166093636 19:40526110-40526132 ACTTAGAGCTTCAGCTTGCCTGG + Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
925355739 2:3239749-3239771 ACTCAGGGCATCCCCCTTCCTGG + Intronic
927184143 2:20470052-20470074 ACTTGGGGCATCTGTCTCCCTGG + Intergenic
928335699 2:30396221-30396243 ACTTAGGTGATCAGCCTCCCAGG + Intergenic
928373832 2:30759404-30759426 GCTGAGGGCTGCCGGCTCCCGGG - Intronic
932625638 2:73293593-73293615 GCTCCGGGCTTCCGACTCCCCGG + Exonic
934685883 2:96321450-96321472 CCGTGGGGCTTCCGCCGCCCTGG + Intergenic
935054547 2:99554266-99554288 ACCAGGGGCTTCCGCCTCCCGGG - Intronic
937418699 2:121737511-121737533 ACTTCCAACTTCCGCCTCCCGGG + Intronic
943022855 2:182596395-182596417 ACCTAAGTCTTCAGCCTCCCTGG - Intergenic
945807615 2:214509503-214509525 AGTCAAGGCTTCCACCTCCCAGG - Intronic
1169366105 20:4994012-4994034 ACTTGCAGCTTCTGCCTCCCGGG - Intronic
1173783057 20:45772448-45772470 ACTTGGAACTTCCACCTCCCAGG + Intronic
1174348330 20:49948304-49948326 ACTTAGGTCTTCTCTCTCCCTGG + Intronic
1175762378 20:61570413-61570435 ACTTTGGGCTTCAGCAGCCCTGG + Intronic
1178284672 21:31315597-31315619 ACTTACAACCTCCGCCTCCCTGG - Intronic
1181505764 22:23355777-23355799 ACTTAGGGGGTCAGACTCCCTGG - Intergenic
1182434782 22:30323538-30323560 ACTTAGGGTTTCTGACTCCCAGG - Intronic
1183513426 22:38249223-38249245 CCCTGCGGCTTCCGCCTCCCGGG + Intronic
954364725 3:50139745-50139767 GCTGAGGGCTTCAGCCTCCCAGG - Intergenic
956735153 3:72232606-72232628 TCTTAGGGCTTCTGCCTCTGGGG - Intergenic
961182543 3:124887549-124887571 CCGTAGGGCCTCCGCGTCCCGGG - Intronic
964701070 3:159567464-159567486 ACTTAGGAATTCTGTCTCCCTGG + Intronic
969247503 4:5945139-5945161 ACCTGGAGCTTCCTCCTCCCAGG - Intronic
969969225 4:11028675-11028697 AGTTAGGGCCTGCTCCTCCCTGG + Intergenic
972892002 4:43568597-43568619 ATTTATGCCTTCAGCCTCCCTGG - Intergenic
976261037 4:83144863-83144885 ACTTATAGCCTCCGCCTCCCAGG - Intergenic
978890628 4:113822248-113822270 ACTTTAGGCTTCTGACTCCCAGG - Intergenic
981084939 4:140673901-140673923 CCTTCTGGCTTCCCCCTCCCGGG - Intronic
982197634 4:152932901-152932923 TCTTATGGCTTCTGCCTCCTTGG - Intergenic
986377214 5:7144372-7144394 ACTTAGGGCTTAGGCCTATCTGG + Intergenic
990559197 5:56966765-56966787 CCTCAGGGCTTCCTCTTCCCAGG + Intronic
990591167 5:57266417-57266439 GCTTATGGCCTCCGCCTCCCAGG - Intergenic
990990483 5:61678795-61678817 ACTTAGGGCTCAAACCTCCCTGG - Intronic
992150231 5:73895309-73895331 ACTTAGTCCTTCCACCACCCTGG - Intronic
992507407 5:77400711-77400733 ACTTGGTGCTTCTGCCTCCCAGG - Intronic
1002129434 5:177071098-177071120 ACTTAGGGCTCCTGAATCCCAGG - Intronic
1002587127 5:180256361-180256383 ACTTAGGGCTCCTCCCTTCCTGG + Intronic
1002910799 6:1489551-1489573 ACCTTGGGCTTCCAGCTCCCAGG - Intergenic
1003941229 6:11029150-11029172 CCCTACAGCTTCCGCCTCCCAGG - Intronic
1005478554 6:26233421-26233443 GCTTACAACTTCCGCCTCCCGGG + Intergenic
1010435053 6:75820125-75820147 ATTTAGGGCTTCAGCCTACAAGG - Intronic
1011689241 6:89850765-89850787 ACCTCTGCCTTCCGCCTCCCAGG - Intronic
1015019578 6:128456290-128456312 CATTTGGGCTTCTGCCTCCCTGG - Intronic
1017741302 6:157409217-157409239 ACTTTCTGCTTCCGCGTCCCAGG + Intronic
1019427414 7:984136-984158 ACTCAGGGCTTGAGCCCCCCAGG + Intronic
1019485484 7:1287457-1287479 ACTCAGGGACGCCGCCTCCCAGG - Intergenic
1019547792 7:1586799-1586821 ACCTGGGGCTCCAGCCTCCCAGG - Intergenic
1020062672 7:5164262-5164284 ACTGCAAGCTTCCGCCTCCCAGG - Intergenic
1025151733 7:56560189-56560211 CCTTACGGCCTCCGCCTCCCGGG + Intergenic
1025607898 7:63052674-63052696 ACCTGGGACCTCCGCCTCCCAGG + Intergenic
1025813287 7:64888874-64888896 ACTCAGGGCCTCCGTTTCCCTGG - Intronic
1027407312 7:77875277-77875299 ACATAGATCTTCCACCTCCCTGG + Intronic
1038176034 8:25183286-25183308 ACTTATAGCCTCTGCCTCCCGGG + Intergenic
1038562404 8:28591537-28591559 ACTTAGGGCTCCTGGATCCCTGG + Intergenic
1039895332 8:41713095-41713117 GCTTAGGGCCTCCGCAGCCCAGG - Intronic
1040626797 8:49158758-49158780 ACTGCGAGCTCCCGCCTCCCGGG - Intergenic
1041382277 8:57261854-57261876 ACTTGGGCCCTCCGCCTCCAAGG - Intergenic
1046955906 8:120062747-120062769 ACTGAGGGCATCTGCCTCCTAGG + Intronic
1051620970 9:19049273-19049295 TCTTAGGGCTCACGCCGCCCCGG + Intronic
1060107922 9:120885848-120885870 ACTTAGGTATTCCTCCACCCAGG - Intronic
1061373944 9:130213140-130213162 ACCCAGGGCTCCTGCCTCCCAGG - Intronic
1062247308 9:135575777-135575799 ACTGGAGGCCTCCGCCTCCCGGG - Intergenic
1191786340 X:64920689-64920711 ACTTAGGGCTTCCGCCTCCCAGG + Intronic
1195928325 X:110048605-110048627 ACTTAGGCCTTCTGACTTCCAGG + Intronic
1196808752 X:119611905-119611927 ACTTGCAGCCTCCGCCTCCCGGG + Intergenic
1197264189 X:124348430-124348452 ACCTAAGGCTTCAGCCTCACGGG + Intronic
1201551478 Y:15221309-15221331 AGTTATGACTTCCGTCTCCCAGG - Intergenic