ID: 1191787349

View in Genome Browser
Species Human (GRCh38)
Location X:64930694-64930716
Sequence CAGTTTTATCATAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191787349_1191787353 16 Left 1191787349 X:64930694-64930716 CCTGCATCCCTATGATAAAACTG 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1191787353 X:64930733-64930755 TTATCTTTTTAATATGCTGTTGG 0: 20
1: 384
2: 954
3: 1237
4: 2985
1191787349_1191787355 23 Left 1191787349 X:64930694-64930716 CCTGCATCCCTATGATAAAACTG 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1191787355 X:64930740-64930762 TTTAATATGCTGTTGGATTTGGG 0: 1
1: 3
2: 15
3: 122
4: 868
1191787349_1191787354 22 Left 1191787349 X:64930694-64930716 CCTGCATCCCTATGATAAAACTG 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1191787354 X:64930739-64930761 TTTTAATATGCTGTTGGATTTGG 0: 9
1: 266
2: 1323
3: 8588
4: 4468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191787349 Original CRISPR CAGTTTTATCATAGGGATGC AGG (reversed) Intronic
903090883 1:20915539-20915561 AAGTTTTATCCCAGGGAAGCAGG + Intronic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
909649518 1:77958538-77958560 CAGATTTATCAAAGGGTTACTGG - Intronic
910143113 1:84048923-84048945 GAGTTTTTTTATAAGGATGCAGG + Intergenic
910594645 1:88967008-88967030 AAGGTTTACCATAGGAATGCAGG - Intronic
912894660 1:113574272-113574294 CAGTTTCTTCATAGGGTTGTTGG + Intronic
913706638 1:121431472-121431494 CTGTTTTATAACAGGGATGAGGG - Intergenic
915944334 1:160138941-160138963 CCTTTTTATCATAGGGTTGCTGG - Intronic
924235739 1:241998418-241998440 CAGTTTTATTTTGGGGATGGGGG - Intronic
924386694 1:243505843-243505865 AAGTTTTATCATAGGGAAATTGG - Intronic
924747083 1:246846283-246846305 TCGTTTTTACATAGGGATGCAGG - Intronic
1064143164 10:12807089-12807111 CAGGTGTATCATGGGGGTGCTGG - Intronic
1066619473 10:37329808-37329830 AGGTTTTATCCTAGGGATGCAGG + Intronic
1067098210 10:43316111-43316133 CAGTTCTACCAAAGGGATCCGGG - Intergenic
1068268217 10:54682078-54682100 CAGTTATTGCATAGGGATGATGG + Intronic
1068584709 10:58783806-58783828 CAGTTTTATCATAAAGCTGATGG + Intronic
1069223963 10:65918128-65918150 CATTTTTATCAAAGAGATGGAGG + Exonic
1071469352 10:85970480-85970502 GAGATTTATCCTAGGAATGCAGG + Intronic
1072487644 10:95871545-95871567 CAGTTTTATCACAGGTATAATGG + Exonic
1073933479 10:108602215-108602237 CATTTTAATCAAAGGAATGCTGG - Intergenic
1078948608 11:16101690-16101712 CAGTTTCATACTAGGGATGCAGG + Intronic
1079749389 11:24178106-24178128 CAGTTCTATTATGAGGATGCTGG + Intergenic
1080895819 11:36448176-36448198 CAGCTTTCTCATATGGCTGCAGG - Intronic
1082096510 11:48135112-48135134 CAGTTTTTTTATATGGGTGCTGG - Intronic
1087631177 11:100652298-100652320 GGGTTTTATATTAGGGATGCAGG + Intergenic
1087696380 11:101381306-101381328 CAATTTTATCTTGGGGAGGCTGG - Intergenic
1088413501 11:109563761-109563783 GAGTTTTATACCAGGGATGCAGG - Intergenic
1092603005 12:10087278-10087300 GGGTTTTATCCCAGGGATGCAGG + Intronic
1094158620 12:27365307-27365329 AAGTTTCATCCTAGGGATGCAGG - Intronic
1095529989 12:43175664-43175686 AAATTTTATCACAGGGATGGGGG + Intergenic
1098093982 12:66935179-66935201 AAATTTTATTATAGGAATGCTGG - Intergenic
1098326260 12:69305843-69305865 CATTTTTTTCATAGGGTTGTTGG + Intergenic
1098958206 12:76709456-76709478 TAGTTATATCATATTGATGCGGG + Intergenic
1101059132 12:100952684-100952706 CAGTTTTATCAAATTGATGATGG + Intronic
1104220358 12:126776659-126776681 CATTTTTAAAATAGTGATGCAGG - Intergenic
1105063601 12:133177083-133177105 GAGTGTTATACTAGGGATGCAGG + Intronic
1106979758 13:35264559-35264581 GAGATTCATCCTAGGGATGCAGG + Intronic
1108957433 13:56178003-56178025 GAGTTTCATCAAAGGCATGCAGG - Intergenic
1110481247 13:75979367-75979389 TAGTTTTATCAAAGTGATACAGG - Intergenic
1111327501 13:86718740-86718762 CAAATTTATCATTGGGATGCAGG + Intergenic
1111773484 13:92628606-92628628 CAGTTTAGTCACAGTGATGCTGG - Intronic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1114960759 14:27885574-27885596 AAATTTTATCATAGGTATGTAGG - Intergenic
1115465632 14:33711567-33711589 CTGTTTTATGATAGTGCTGCAGG + Intronic
1116742108 14:48769010-48769032 AATATTTATCATAGGGATGTTGG - Intergenic
1118507624 14:66430796-66430818 CAGTTTTCTCATTAGGATGTTGG + Intergenic
1120502435 14:85313276-85313298 CAGTTTTAAAAGAGGAATGCAGG - Intergenic
1120553901 14:85905993-85906015 CAGTTTTTTCATAGTGTTGATGG + Intergenic
1122170714 14:99872278-99872300 CAATTTTATCTTAGGGAAGAAGG + Intronic
1124224895 15:27884976-27884998 AAGCTTCATCATAGGAATGCTGG - Intronic
1125925951 15:43563303-43563325 TAGCTTTATCATAGGTAGGCTGG + Intronic
1125939095 15:43662854-43662876 TAGCTTTATCATAGGTAGGCTGG + Intronic
1127284146 15:57517906-57517928 CAGTTTTATAAAAGGTATCCAGG - Intronic
1137814388 16:51384405-51384427 CAGTTTAATCCTAAGGATGGTGG - Intergenic
1140213769 16:72991270-72991292 AAATTTTATCATAGGCATGTAGG + Intronic
1141002373 16:80319911-80319933 CAGTCTTATCAAGAGGATGCAGG - Intergenic
1141032181 16:80598657-80598679 CACTTTTATGATATGGATACAGG + Exonic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1148188604 17:45662831-45662853 AAGTTTAATCATAGGGTTGCTGG + Intergenic
1148704382 17:49616293-49616315 CAGTTGTTTCATAGGGATTCTGG - Intronic
1151498841 17:74475888-74475910 CAGTTTTATCATAAGGATAAAGG + Intronic
1203165168 17_GL000205v2_random:87143-87165 AACTTTCATCACAGGGATGCAGG - Intergenic
1153023413 18:652606-652628 CAACTTTATCATAGGTATGTAGG + Intronic
1154146618 18:11871948-11871970 CATTTTCATATTAGGGATGCTGG - Intronic
1158939018 18:62389690-62389712 CAGTTTTATGAATGGGATGAAGG - Exonic
1158950928 18:62494073-62494095 AACTTTTATCATAGGTATGTAGG + Intergenic
1159200631 18:65179325-65179347 TAGTTGTATCATGGTGATGCAGG - Intergenic
1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG + Intronic
1163903508 19:20129583-20129605 CAGCTTTATCACAAGGCTGCTGG - Intergenic
1163923213 19:20313012-20313034 CAGTTCTAACGTAGGGATTCAGG - Intergenic
1164422693 19:28110137-28110159 GAGTTTTATTCCAGGGATGCAGG + Intergenic
1166186941 19:41146175-41146197 CATTTTTTTCATAGGTTTGCTGG + Intergenic
1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG + Intergenic
925133857 2:1512870-1512892 CAGTATAATCATAAGGGTGCTGG - Intronic
925985813 2:9213792-9213814 CAGCTTCACCATGGGGATGCTGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926970427 2:18462292-18462314 CACTTTCTTCATAGGGATGATGG + Intergenic
928605618 2:32943128-32943150 CAGTTTAATGCTATGGATGCTGG - Intergenic
928815358 2:35288328-35288350 GAGTTTTATTTCAGGGATGCAGG - Intergenic
930440104 2:51393554-51393576 CAGTTTCTTCATAGGGTTGATGG - Intergenic
930860132 2:56063628-56063650 CAGTTTTTTCATAGTGTTGGTGG + Intergenic
932528980 2:72505565-72505587 TAGTTTTATTATAGGGAAGATGG - Intronic
937411009 2:121675511-121675533 GGGTTTTATACTAGGGATGCAGG + Intergenic
939224667 2:139349889-139349911 CAGTTTCTTCATAGTGATGATGG - Intergenic
940056709 2:149520812-149520834 CAATTTTATCCAAAGGATGCTGG + Intergenic
944116694 2:196195025-196195047 TGTTTTTATAATAGGGATGCAGG - Exonic
944286993 2:197962219-197962241 CAGTCTGCTCATAGGTATGCTGG - Intronic
945329521 2:208523617-208523639 CAGTTTTTTCATAGTGTTGGTGG + Intronic
945666927 2:212754838-212754860 CAGTTTTTTCATAGTGTTGATGG - Intergenic
948524037 2:238559581-238559603 CAGCTTTATGACAGGGATGATGG - Intergenic
1172162632 20:32879173-32879195 CAGTTTCATCATAGGGGCACAGG + Intronic
1172277696 20:33688999-33689021 CAGTTTCATGCTAGGAATGCTGG - Intergenic
1175000122 20:55618728-55618750 GAGTTTCATAACAGGGATGCAGG - Intergenic
1176406582 21:6371948-6371970 AACTTTCATCACAGGGATGCAGG + Intergenic
1176904018 21:14478460-14478482 CTGCTTTATCATATGGTTGCTGG + Intergenic
1177329140 21:19633436-19633458 CAGTTTCATACCAGGGATGCAGG + Intergenic
1177364247 21:20113758-20113780 GGGTTTTATACTAGGGATGCAGG - Intergenic
1177935108 21:27335377-27335399 CAGTTTCCTACTAGGGATGCAGG + Intergenic
1178802046 21:35805082-35805104 GAGTTTTATACCAGGGATGCGGG + Intronic
1179009930 21:37548640-37548662 CAGTTTTATCACCGTGTTGCAGG - Intergenic
1182207743 22:28645665-28645687 GGGTTTCATCCTAGGGATGCTGG + Intronic
950593954 3:13961873-13961895 GAGTTTCATCCCAGGGATGCAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950991858 3:17448164-17448186 CAGTTTTATCATGAGATTGCAGG + Intronic
951973129 3:28471416-28471438 GGGTTTTATCCCAGGGATGCAGG + Intronic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
953933826 3:47022327-47022349 CAGTTTTTTTATAGAGATGCTGG - Intronic
954063082 3:48085470-48085492 AAATTTTAACAAAGGGATGCTGG + Intronic
955137320 3:56232623-56232645 CAGTTTTTTCTTTGGGTTGCTGG - Intronic
955635162 3:61020583-61020605 CAGTTTTTTCATAGTGTTGATGG - Intronic
959666176 3:108924469-108924491 GGGTTTTATATTAGGGATGCAGG - Intronic
962693215 3:137922130-137922152 CAGTTTGAACATGGGGATTCTGG - Intergenic
962977819 3:140461354-140461376 CTGTTGTCTCATTGGGATGCTGG - Intronic
963832834 3:150026734-150026756 GGGTTTTATACTAGGGATGCAGG + Intronic
964264362 3:154877032-154877054 CAGTTTTTTCATAGTGTTGATGG - Intergenic
964300618 3:155281131-155281153 TGGTTTTATCCCAGGGATGCAGG + Intergenic
964635668 3:158855997-158856019 GAGTTTCATCCCAGGGATGCAGG - Intergenic
964800825 3:160555492-160555514 AAGTTTTATCATAGATATGTAGG - Intronic
964969955 3:162547696-162547718 CAGTTTTAACATACTCATGCAGG + Intergenic
965291272 3:166884841-166884863 GGGTTTCATCTTAGGGATGCAGG + Intergenic
965345097 3:167538640-167538662 CACTTTGTTCATAGTGATGCAGG + Intronic
965418246 3:168424589-168424611 CAGTTTTCTCATATGTATGACGG + Intergenic
967311773 3:188113017-188113039 CTGTTCTATCATGGTGATGCTGG + Intergenic
968553206 4:1234737-1234759 CGGTTTTCTCATTGGGAAGCTGG - Intronic
968639431 4:1704748-1704770 CACTTTTATTATATGGATACAGG - Intronic
969117285 4:4878585-4878607 CAGTTTTTTCATCTGGATGATGG + Intergenic
973764511 4:54150914-54150936 CAGTTTTCTCATATGTAAGCTGG + Intronic
976027013 4:80700406-80700428 CAGTATTATCAGTGGGATGGTGG + Intronic
976582432 4:86753350-86753372 CAGTTATTTTAAAGGGATGCTGG + Intronic
979538164 4:121848619-121848641 AAATTTTATCATAGGCATGTAGG + Intronic
983175392 4:164582308-164582330 GGGTTTCATCCTAGGGATGCAGG - Intergenic
983477442 4:168231526-168231548 GAGTTTCATACTAGGGATGCTGG + Intronic
984420162 4:179511532-179511554 CTGTTTTATGAAAGGGGTGCTGG + Intergenic
984751091 4:183275631-183275653 GAGATTTATCCTAGGAATGCAGG - Intronic
1202757562 4_GL000008v2_random:79356-79378 TATTTTTATCACAGGGATGTTGG + Intergenic
986227682 5:5831574-5831596 GAGTTTTATCCCAGGAATGCAGG + Intergenic
986373022 5:7099623-7099645 AAGTTTTAAAATAGAGATGCTGG + Intergenic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
989271351 5:39537110-39537132 CAGTTATAACATAGGGTTGCTGG - Intergenic
989365903 5:40654822-40654844 GAGTTTCATCCCAGGGATGCAGG + Intergenic
990899120 5:60730931-60730953 CAGTTTTTTCATAGTGTTGATGG - Intergenic
991047855 5:62241557-62241579 AACTTTTATTATAAGGATGCAGG - Intergenic
991137224 5:63196050-63196072 GGGTTTTATCCAAGGGATGCAGG + Intergenic
994463301 5:100094399-100094421 GGGTTTTATACTAGGGATGCAGG - Intergenic
994761576 5:103861160-103861182 CAGCTTTATCCTAGCCATGCTGG - Intergenic
995056516 5:107765473-107765495 CAATTTTCTCTTTGGGATGCTGG + Intergenic
996141038 5:119909612-119909634 CAGTTTTATACAAGAGATGCAGG - Intergenic
998683073 5:144492554-144492576 GAGTTTTATCTTAGGGAAGCAGG + Intergenic
998815796 5:146013079-146013101 CAGTCTTAGCATAAGGATTCAGG + Intronic
999575226 5:152968945-152968967 AGGTTTTATCCCAGGGATGCAGG + Intergenic
999844228 5:155460782-155460804 CACCTTTATCTTAGGGCTGCAGG - Intergenic
1000736719 5:164911861-164911883 CAGTTTTATCCAGGGGATGTGGG + Intergenic
1000819286 5:165964052-165964074 CAGTTTTAGCATAAGGATCCGGG + Intergenic
1008781525 6:55111955-55111977 AGGTTTTATAGTAGGGATGCAGG + Intronic
1010015244 6:71097857-71097879 GAGTTTCATCCTAGGGATGCAGG - Intergenic
1010114916 6:72292875-72292897 CAGTTGTTTCATAGGGATAAAGG - Intronic
1010260594 6:73811497-73811519 CAGTTTTATCATATGTATGATGG - Intronic
1010499875 6:76584439-76584461 CAGTTTTATCCTATAGAGGCTGG - Intergenic
1010868018 6:81004603-81004625 CAATTGAATCATAGGGGTGCTGG + Intergenic
1011663093 6:89610894-89610916 CAGTACTAAAATAGGGATGCTGG + Intronic
1012200049 6:96394724-96394746 GAGTTTTACTATAGGGATGTAGG + Intergenic
1012857081 6:104514837-104514859 GAGTTTTATCATAGTTATGATGG - Intergenic
1012923053 6:105239386-105239408 GAGTTTTATACCAGGGATGCAGG + Intergenic
1014532336 6:122573588-122573610 GGGTTTTATCTCAGGGATGCAGG + Intronic
1017862378 6:158410970-158410992 CTGGTTTATCATAGGCAGGCAGG + Intronic
1020975771 7:15004119-15004141 CAATTTTATAAGAGGGAGGCAGG - Intergenic
1022118987 7:27288580-27288602 CAGTTCTTGCATAGGGATGAGGG - Intergenic
1022483982 7:30763699-30763721 CAAATTGATTATAGGGATGCTGG - Intronic
1025161700 7:56666985-56667007 CAGTTATATCATCTGGAAGCTGG - Intergenic
1026539512 7:71268034-71268056 CCATTTTTTCAGAGGGATGCTGG + Intronic
1028429198 7:90727691-90727713 CAGTTTTGTCATATAGTTGCAGG - Intronic
1029014691 7:97303555-97303577 CAGTTTCCTCATAGGAATGTTGG + Intergenic
1029053484 7:97714847-97714869 GGGTTTTATAACAGGGATGCAGG + Intergenic
1030705425 7:112688250-112688272 CAGTTTTTTCATAGTGTTGATGG + Intergenic
1031148114 7:118019950-118019972 CAGTTTCATACCAGGGATGCAGG + Intergenic
1041049372 8:53918063-53918085 CAATTTTATAAAAGGAATGCAGG - Intronic
1043246681 8:78012092-78012114 GGGTTTTATCAGAGGGAAGCAGG + Intergenic
1043265816 8:78266609-78266631 CAGTTTTATAAAAGGGAAACGGG + Intergenic
1045020193 8:98036279-98036301 CATTTTTTTCATAGGCATGTTGG - Exonic
1045332006 8:101163264-101163286 AAGTTTTATCATGGAGATGAAGG + Intergenic
1046117932 8:109806795-109806817 CAGTTTGAACATAAGGATGGGGG + Intergenic
1046351034 8:113012785-113012807 CTGTATTATCAAAGGGATGTTGG - Intronic
1047887564 8:129268808-129268830 CAATTTTATGATATGGATGCTGG - Intergenic
1048949307 8:139481201-139481223 CATTTTTATTACATGGATGCTGG - Intergenic
1049075501 8:140392872-140392894 TGGTTGTATCAAAGGGATGCAGG - Intronic
1050618166 9:7425070-7425092 AGGATTTATCCTAGGGATGCAGG - Intergenic
1051441188 9:17085109-17085131 AAGCTTTATCATAGGTATGTAGG + Intergenic
1055426527 9:76202455-76202477 CAGTTTTATCCTAGGGAACTGGG - Intronic
1055820525 9:80256475-80256497 CAGTTTAATCTTAGGCATTCTGG + Intergenic
1056195276 9:84222766-84222788 CAGTTTTATCATATGTAAGATGG + Intergenic
1061379461 9:130245301-130245323 CACGTTTCTCATAGGGCTGCTGG + Intergenic
1203538353 Un_KI270743v1:64218-64240 TATTTTTATCACAGGGATGTTGG + Intergenic
1186995256 X:15114626-15114648 CAGTTTTAAAATATGTATGCAGG - Intergenic
1189478721 X:41376803-41376825 CACTTCTAGCATAGGGATTCAGG + Intergenic
1189978214 X:46484146-46484168 CAGTTTCTTCATAGGGTTGGTGG + Intronic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1191976924 X:66883093-66883115 CAGTTTTTTTATAGAGATGGGGG + Intergenic
1192885337 X:75331140-75331162 GGGTTTCATCCTAGGGATGCAGG - Intergenic
1192904024 X:75530466-75530488 GAGTTTTATCCCAGGGATGCAGG - Intergenic
1192984468 X:76381762-76381784 CAGTTTTTTCATAGTGTTGATGG - Intergenic
1192995705 X:76510699-76510721 GAGTTCCATCCTAGGGATGCAGG + Intergenic
1193182458 X:78474187-78474209 GAGTTTTATACCAGGGATGCAGG - Intergenic
1193775679 X:85638562-85638584 CAGTTTCATACAAGGGATGCAGG - Intergenic
1193826185 X:86230291-86230313 GAGTTTCATCCCAGGGATGCAGG - Intronic
1194557194 X:95374735-95374757 GAGTTTCATCCTAGGGATACAGG + Intergenic
1194985811 X:100488495-100488517 CGGTTTTATTATAAGGATGATGG - Intergenic
1197123940 X:122922718-122922740 CAGCTTTATCCCTGGGATGCAGG - Intergenic
1199154317 X:144528760-144528782 GAGATTTATCAAAGGGATGCAGG + Intergenic
1199406032 X:147461836-147461858 CATTTTTTTCATAGGGCTGTTGG - Intergenic
1199535243 X:148895283-148895305 CATTTTTATTGTAGGGATACAGG + Intronic
1200854056 Y:7918280-7918302 AAGTCATATCATAAGGATGCTGG + Intergenic