ID: 1191791449

View in Genome Browser
Species Human (GRCh38)
Location X:64976275-64976297
Sequence CGCAACGAAGGGTTGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191791439_1191791449 3 Left 1191791439 X:64976249-64976271 CCAACAATAGATAATTAGCCCTC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1191791449 X:64976275-64976297 CGCAACGAAGGGTTGGAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1191791436_1191791449 25 Left 1191791436 X:64976227-64976249 CCAGCTCCTCTAGACAAACAGCC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1191791449 X:64976275-64976297 CGCAACGAAGGGTTGGAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1191791435_1191791449 30 Left 1191791435 X:64976222-64976244 CCTTTCCAGCTCCTCTAGACAAA 0: 1
1: 0
2: 2
3: 25
4: 184
Right 1191791449 X:64976275-64976297 CGCAACGAAGGGTTGGAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1191791438_1191791449 4 Left 1191791438 X:64976248-64976270 CCCAACAATAGATAATTAGCCCT 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1191791449 X:64976275-64976297 CGCAACGAAGGGTTGGAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1191791437_1191791449 19 Left 1191791437 X:64976233-64976255 CCTCTAGACAAACAGCCCAACAA 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1191791449 X:64976275-64976297 CGCAACGAAGGGTTGGAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191791449 Original CRISPR CGCAACGAAGGGTTGGAGAG GGG Intronic