ID: 1191793118

View in Genome Browser
Species Human (GRCh38)
Location X:64992304-64992326
Sequence AATCTGAGCCTGTCGGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191793118 Original CRISPR AATCTGAGCCTGTCGGAGAT TGG (reversed) Intronic
900200043 1:1400415-1400437 AATTTGAGCCCGTCTGAGCTGGG - Intronic
903560690 1:24224826-24224848 GATCTGGGCCTGGCGGAGCTTGG + Intergenic
907989908 1:59570128-59570150 AATCAGACCCTGTGGGAGAGGGG - Intronic
909328183 1:74379526-74379548 AAACTGAGCATGTCAGAAATGGG - Intronic
910789657 1:91038105-91038127 AATATGAGTCTGTCAGAAATAGG - Intergenic
913591849 1:120336585-120336607 ACTGTGAGCCTCTTGGAGATGGG - Intergenic
913645108 1:120847947-120847969 TCTCGGAGCCTGTCGGAGTTTGG - Intergenic
913651507 1:120918561-120918583 ACTGTGAGCCTCTTGGAGATGGG + Intergenic
914081618 1:144415595-144415617 TCTCGGAGCCTGTCGGAGTTTGG + Intergenic
914099481 1:144571243-144571265 TCTCGGAGCCTGTCGGAGTTTGG - Intergenic
914169603 1:145210509-145210531 ACTGTGAGCCTCTTGGAGATGGG - Intergenic
914176526 1:145284138-145284160 TCTCGGAGCCTGTCGGAGTTTGG + Intergenic
914299502 1:146366434-146366456 TCTCGGAGCCTGTCGGAGTTTGG + Intergenic
914524715 1:148454471-148454493 ACTGTGAGCCTCTTGGAGATGGG - Intergenic
914531253 1:148525617-148525639 TCTCGGAGCCTGTCGGAGTTTGG + Intergenic
914598959 1:149181362-149181384 ACTGTGAGCCTCTTGGAGATGGG + Intergenic
914637137 1:149562123-149562145 TCTCAGAGCCTGTCGGAGTTTGG - Intergenic
914641684 1:149612664-149612686 ACTGTGAGCCTCTTGGAGATGGG + Intergenic
914864488 1:151415172-151415194 AGTCGGAGCCTGTCGGGGTTGGG - Intronic
916991321 1:170248783-170248805 AATATGACCCTGTTGGAAATAGG + Intergenic
917923110 1:179767178-179767200 AATCTGAGCATGCCAGAGAGTGG - Intronic
918983800 1:191596721-191596743 ATTCTGAGCCTGAGGGAGCTGGG + Intergenic
922669106 1:227495238-227495260 AATCTGAGGCTGGGGGAGGTGGG - Intergenic
922670491 1:227506064-227506086 AATCTGAGGCTGGGGGAGGTGGG + Intergenic
923679382 1:236106951-236106973 AAACTGAGGCTGAGGGAGATGGG + Intergenic
924461812 1:244266315-244266337 AATCTGGGCCTGGCTGAGCTGGG - Intergenic
1068475855 10:57523568-57523590 AATCAGAGCATGTTGGAGATAGG - Intergenic
1069813982 10:71181806-71181828 ACTGTGAGCCTGTGGGAGGTGGG + Intergenic
1081652765 11:44835371-44835393 GATCTAAGCCTGTCTGAGAAGGG - Intronic
1084314962 11:68340299-68340321 AAACTGAGGCTCTGGGAGATGGG + Intronic
1085445158 11:76596572-76596594 AATGTGACCTTTTCGGAGATGGG + Intergenic
1094250364 12:28353144-28353166 AATCTGAGGTTATCAGAGATTGG - Intronic
1094495982 12:30989634-30989656 AAGCTGAGCATGTTGGAGGTGGG - Intronic
1096481081 12:51941457-51941479 AATCTGAGCCTGGGGCAGACCGG - Intergenic
1102671150 12:114620110-114620132 CACCTGGGCCTGTCGGAGGTCGG - Intergenic
1104017042 12:124968437-124968459 TTTCTGAGCCACTCGGAGATGGG + Intronic
1104997482 12:132667646-132667668 AATCTAAGCACGACGGAGATGGG + Exonic
1106771775 13:32968336-32968358 GTGCTGAGCCTGTAGGAGATGGG - Intergenic
1108262130 13:48668763-48668785 CATCAGAGCCTGTCGGGGGTTGG - Intronic
1123114535 14:105888705-105888727 AAACTGAGCCTGTCTCAGAGAGG + Intergenic
1126699294 15:51353492-51353514 TAGCTGAGCCAGTCGGAGAGTGG - Intronic
1129035725 15:72647386-72647408 AATCTGCACCTGCAGGAGATCGG - Intergenic
1129399850 15:75275539-75275561 AATCTGCACCTGCAGGAGATCGG - Intronic
1136366450 16:29811388-29811410 ATTCTGGGCCTGTCCGAGTTGGG - Intronic
1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG + Intronic
1139913926 16:70416779-70416801 AATCTGAGCCTGTGGGAAAGGGG + Intronic
1145778179 17:27543928-27543950 AATCTGCCCGTGTCAGAGATGGG - Intronic
1156405240 18:36776862-36776884 TCTCTGAGCCTGTCCCAGATAGG + Intronic
1157191381 18:45585089-45585111 AATCTGATGCTGAGGGAGATGGG - Intronic
1157198980 18:45643007-45643029 AATCTGAGGCTGCAGGAGAGAGG + Intronic
1162217780 19:9150543-9150565 AATGTGGACCTGTGGGAGATGGG + Intronic
1163084514 19:14969650-14969672 AAGCAGAGCCTGACTGAGATGGG - Intronic
936267913 2:111024268-111024290 AATGTGACCCTGTTGGAAATAGG + Intronic
938027224 2:127960287-127960309 ATTCAGAGCCTGGCGGAGAAAGG + Intronic
938150203 2:128875815-128875837 AAAGTGAGCCTGTGGGGGATGGG + Intergenic
939837596 2:147150018-147150040 CTTCTGAGCCTGTCGGGGATGGG - Intergenic
941518179 2:166505756-166505778 AATCTGGGCCTGTCAGAGGGTGG - Intergenic
945767952 2:214003226-214003248 TATCTGACACTGTGGGAGATCGG + Intronic
1169343719 20:4814309-4814331 AATCTGAGCTTGTAGGAAACAGG - Intronic
1171169909 20:23006830-23006852 AATCAGAGGCTGTGGGAGGTAGG - Intergenic
1171775367 20:29362487-29362509 AATCTGAGGCTGAGGGAGGTGGG - Intergenic
1172331317 20:34077753-34077775 ACTCTGAGTCTGTGGGATATGGG + Intronic
1177626372 21:23665692-23665714 ATTCTGAGCCTGTCATATATGGG - Intergenic
1177794574 21:25760352-25760374 AATCAGTGCCTTTCGCAGATAGG - Intronic
1184512912 22:44943496-44943518 TAGCTGAGCCTGCTGGAGATCGG - Intronic
1185011453 22:48316853-48316875 AATTGGAGCCTGTGGGAGAGAGG + Intergenic
952156256 3:30646907-30646929 AATGTGAGCATGTCGAAGAGAGG + Intronic
952753175 3:36842185-36842207 AATCTGAGTCTGGTGAAGATAGG - Intronic
959385305 3:105698022-105698044 AATCTGAGACTTTCAGAGAATGG + Intronic
962517646 3:136168596-136168618 CATCTGAGCCTGTTGGGGGTAGG + Intronic
968730076 4:2265362-2265384 AAGCTGAGGCTGTGGCAGATGGG - Intergenic
968963363 4:3756929-3756951 AATCAGAGCCTTTCTGGGATGGG + Intergenic
969101176 4:4769296-4769318 AAACTGAGGCTTTGGGAGATGGG + Intergenic
969385069 4:6839233-6839255 AATCTAAACCTGACGGTGATGGG - Intronic
969869786 4:10097450-10097472 GATGTGTGCCTGTCGGGGATTGG - Intronic
970125881 4:12810276-12810298 ATTCTGAACCTGTCAGAAATGGG + Intergenic
970228088 4:13880569-13880591 AAGCTGAGCCTTTGTGAGATGGG + Intergenic
972334655 4:38096851-38096873 AATATCAGCCTGTAGTAGATTGG + Intronic
974468903 4:62293357-62293379 AGTCTGATCCTGTGCGAGATTGG + Intergenic
974500492 4:62694323-62694345 AATTTGAACCTGTCAGAGTTTGG + Intergenic
981235055 4:142405908-142405930 AAGCTAAGCCTGGAGGAGATGGG + Intronic
982827479 4:160019134-160019156 AAGCTGAGCCTGCTGGAAATGGG - Intergenic
985871121 5:2557482-2557504 GAGGTGAGCCTGTCTGAGATCGG - Intergenic
989744211 5:44808859-44808881 AATCTGAGCCAGTCTGGGAAAGG - Intergenic
989812699 5:45696340-45696362 AAGCTGAGGCTGCCGGAGCTAGG + Intergenic
989983764 5:50672266-50672288 ACTGTGAGCCTCTTGGAGATGGG + Intronic
990532731 5:56689759-56689781 AATCCTAGCTTGTCGGGGATGGG - Intergenic
999202759 5:149827960-149827982 AATCAGAGCCTGTTGGAGCCGGG + Intronic
1005068950 6:21846712-21846734 AATTAAAGCCTGTCAGAGATGGG - Intergenic
1007159747 6:39779358-39779380 AGTCTTAGACTGTCAGAGATGGG + Intergenic
1007545714 6:42692541-42692563 ATTCTGAGCCTGTCTAAGGTGGG + Exonic
1007863525 6:44940730-44940752 AATCTGAGCCTTCCGGTGTTGGG + Intronic
1010925892 6:81745546-81745568 TAACTGAGCCAGTCAGAGATGGG + Intronic
1018373063 6:163186319-163186341 AATCTGAGGGTGTCTGAGAGTGG - Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1032237209 7:130135787-130135809 AAGCTGAGCCTGGTGGAGGTGGG - Intergenic
1033245939 7:139716309-139716331 AATCTGACCTTGTCGGGCATAGG + Exonic
1038216261 8:25564380-25564402 AAGCTGAGCCTGTTGGACAGAGG - Intergenic
1042015145 8:64300768-64300790 CATCTGAGCCTGTGGAGGATTGG + Intergenic
1044025038 8:87158629-87158651 CCTCTGAGCCTGGGGGAGATGGG + Intronic
1045407778 8:101884165-101884187 AATCTGAAGGTGTTGGAGATGGG - Intronic
1048078058 8:131094947-131094969 AATCTAAGCCTGTCTGAATTTGG + Intergenic
1048455281 8:134572381-134572403 CATCTCAGCCTTTCAGAGATGGG - Intronic
1048578908 8:135714902-135714924 AATTTGAACCTGTTGGAGGTGGG - Intergenic
1052271222 9:26630224-26630246 AATCTGAGCATCTAGGAGACAGG + Intergenic
1061064864 9:128271382-128271404 AGCCTGATCCTGTTGGAGATGGG - Intronic
1191793118 X:64992304-64992326 AATCTGAGCCTGTCGGAGATTGG - Intronic
1192806050 X:74510290-74510312 AATCTGAGTCTGTAGGTGCTGGG + Intronic
1199936108 X:152575156-152575178 AAGGTGAGCCAGTGGGAGATAGG - Intergenic
1201069353 Y:10130302-10130324 AATCTGAGGCTGACGGATGTGGG + Intergenic