ID: 1191801632

View in Genome Browser
Species Human (GRCh38)
Location X:65087305-65087327
Sequence TCAGTACTAAAGCCATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191801632_1191801635 -1 Left 1191801632 X:65087305-65087327 CCACCTAATGGCTTTAGTACTGA No data
Right 1191801635 X:65087327-65087349 AGTTGTTTCAAAAAGGAGAAAGG No data
1191801632_1191801636 23 Left 1191801632 X:65087305-65087327 CCACCTAATGGCTTTAGTACTGA No data
Right 1191801636 X:65087351-65087373 TAATTGAATTTAACTAAAGTTGG No data
1191801632_1191801634 -8 Left 1191801632 X:65087305-65087327 CCACCTAATGGCTTTAGTACTGA No data
Right 1191801634 X:65087320-65087342 AGTACTGAGTTGTTTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191801632 Original CRISPR TCAGTACTAAAGCCATTAGG TGG (reversed) Intergenic