ID: 1191801634

View in Genome Browser
Species Human (GRCh38)
Location X:65087320-65087342
Sequence AGTACTGAGTTGTTTCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191801632_1191801634 -8 Left 1191801632 X:65087305-65087327 CCACCTAATGGCTTTAGTACTGA No data
Right 1191801634 X:65087320-65087342 AGTACTGAGTTGTTTCAAAAAGG No data
1191801628_1191801634 30 Left 1191801628 X:65087267-65087289 CCCTCTACCGTGGACATCTTTCT No data
Right 1191801634 X:65087320-65087342 AGTACTGAGTTGTTTCAAAAAGG No data
1191801629_1191801634 29 Left 1191801629 X:65087268-65087290 CCTCTACCGTGGACATCTTTCTT No data
Right 1191801634 X:65087320-65087342 AGTACTGAGTTGTTTCAAAAAGG No data
1191801630_1191801634 23 Left 1191801630 X:65087274-65087296 CCGTGGACATCTTTCTTGCTTTT No data
Right 1191801634 X:65087320-65087342 AGTACTGAGTTGTTTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191801634 Original CRISPR AGTACTGAGTTGTTTCAAAA AGG Intergenic
No off target data available for this crispr