ID: 1191801636

View in Genome Browser
Species Human (GRCh38)
Location X:65087351-65087373
Sequence TAATTGAATTTAACTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191801633_1191801636 20 Left 1191801633 X:65087308-65087330 CCTAATGGCTTTAGTACTGAGTT No data
Right 1191801636 X:65087351-65087373 TAATTGAATTTAACTAAAGTTGG No data
1191801632_1191801636 23 Left 1191801632 X:65087305-65087327 CCACCTAATGGCTTTAGTACTGA No data
Right 1191801636 X:65087351-65087373 TAATTGAATTTAACTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191801636 Original CRISPR TAATTGAATTTAACTAAAGT TGG Intergenic
No off target data available for this crispr