ID: 1191804885

View in Genome Browser
Species Human (GRCh38)
Location X:65124691-65124713
Sequence ATACCTTCTTAGTTTAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191804883_1191804885 21 Left 1191804883 X:65124647-65124669 CCATTTCAATCTTGCTGCTTGTT 0: 161
1: 322
2: 419
3: 365
4: 554
Right 1191804885 X:65124691-65124713 ATACCTTCTTAGTTTAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191804885 Original CRISPR ATACCTTCTTAGTTTAATCT AGG Intergenic
No off target data available for this crispr